Ред барон пузыреплодник: Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron )

Ред барон пузыреплодник: Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron )

Содержание

Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron )


Используя различные сорта пузыреплодников, Вы можете создать у себя великолепные многоуровневые и многоцветные изгороди.

Диаметр кроны взрослого растения (м): 2

Высота взрослого растения (м): 2


Описание

Абсолютно неприхотливое, очень эффектное и быстрорастущее растение. Хорошо переносит городскую загрязненность. Декоративен в течение всего вегетационного периода своими листвой, цветами и плодами. Прекрасно сохраняет свою яркую окраску на солнечных местах, в тенистых – зеленеет. Рекомендован для широкого применения в озеленении города и частных садов. Способен в течение 2–3 лет закрыть проблемные места, создать яркий элемент в сложных контрастных композициях. Живые изгороди из него очень красивые, плотные и лёгкие в уходе. Используя различные сорта пузыреплодников, вы можете создать у себя великолепные многоуровневые и многоцветные изгороди. Результат дальнейшей селекции пузыреплодников, Ред Барон отличается от Диабло менее интенсивной окраской фактурных листьев, меньшими и более компактными размерами и может быть использован в тех композициях, где Диабло либо слишком велик, либо слишком агрессивно тёмен.


Крона Плотный куст с многочисленными прямыми побегами, образующими густую, полушаровидную крону.

Хвоя/Листва Листья 3–5-лопастные (до 7 см), гофрированные по жилкам, вытянутые, уже, чем у Диабло, тёмно-красные, в полной тени – зелёные с лёгким красноватым оттенком, осенью – бронзовые.

Цветение Цветы многочисленные, бледно-розовые, собранные в щитках (до 5см).

Время цветения

июнь,


Плоды Плоды – сборные (вздутые листовки), фиолетово-красные.

Требования Предпочитает солнечные места, выносит полутень и тень, теряя только интенсивность окрашивания. Растёт на всех типах почв, которые в меру увлажнены и имеют хороший дренаж.

Посадка Перед посадкой корни замачивают в воде на 2–5 часов. В посадочную яму глубиной 60 см насыпают горкой питательный грунт. Затем помещают туда куст, расправляют корни и, не заглубляя корневую шейку, засыпают почвой и уплотняют. Обильно проливают почву.
Контейнерные растения можно сажать весь сезон. Посадку растений с голым корнем проводят ранней весной, до распускания листьев, или в сентябре.

Уход

Уход заключается в периодических поливах, подкормках, рыхлении почвы, формирующей обрезке и в обрезке старых побегов. Появляющиеся на солнце зеленые побеги необходимо вырезать полностью.

Не выносит застоя влаги.
Морозостоек, но могут подмерзать молодые побеги.
Удобряют весной – в ведро воды добавляют ½ литра коровяка (либо птичьего помета), 1 л сорнякового настоя или используют другие азотные удобрения. Осенью – в ведре воды настаивают 1 стакан древесной золы или используют другие минеральные удобрения. Приготовленными растворами осуществляют полив кустарника – 15 литров на одно растение.
Устойчив к вредителям.
Устойчив к болезням.


Размножение Размножается черенками, отводками, делением куста, семенами.

посадка и уход, сорта, размножение

Среди множества декоративных кустарников пузыреплодник Ред Барон занимает особое место. Никого не оставляет равнодушным раскидистый куст с ярко-красными, блестящими листьями, покрывающийся в начале лета большими бело-розовыми цветами. Сорт имеет высоту до 2-х. метров, и сохраняет окраску листьев в течении всего теплого периода.

Уход за пузыреплодником

Уход за растением не требует специальной подготовки. Хорошо растет на почвах разного состава, не теряет яркости листа в городских условиях. Переносит загрязненный автомобильными выбросами воздух.

Городские выхлопные газы растению не страшны

На открытых, солнечных участках листья пузыреплодника ярко-красные, образуют густую, плотную крону.

В полутени цвет сохраняется. В тенистых местах листья Ред Барона приобретают бурый оттенок в верхней части и зеленый внизу.

Несмотря на неприхотливость растения, нужно соблюдать необходимые условия, позволяющие пузыреплоднику хорошо расти.

Полив Обязательный полив, в жаркое время 2-3 раза в неделю
Рыхление Регулярно рыхлить почву около стволов. Соблюдать осторожность, чтобы не повредить корни
Обрезка Два раза в год проводить обрезку
Подкормка Весной и осенью осуществлять подкормку
Обработка почвы Весной проводить санитарную обработку почвы вокруг растения

Высадка в открытом грунте

Высаживают саженцы в открытый грунт весной или осенью (апрель, октябрь). Если саженец имеет закрытые корни, т.е. сажается с комом земли на корнях, посадить его можно и летом. Подготовка ямы для саженца не занимает много времени.

  • Выкапываете яму достаточной глубины.
  • Выложить слой питательной почвы на дно.
  • Установить саженец и присыпать землей, смешанной с питательной почвой.
  • Питательная почва содержит в себе смесь равных долей: песок, торф, дерн, земля.
Как и с другими цветами, оптимальная почва – это сочетание нескольких компонентов

Ветки ствола должны быть закопаны в землю не более чем на 1-2 см. После усадки земли через пару дней, добавить землю сверху до ровной поверхности. Не окучивать.

При посадке молодого саженца удобрений не добавлять. Растение будет проходить естественную адаптацию и не сможет усвоить дополнительный прикорм.

После посадки пузыреплодник обильно полить. Через три-четыре дня произвести первое рыхление почвы.

Прикорневую зону обложить торфом для сохранения влаги.

В почве, на которую высаживают куст, не должно быть извести.

Пузыреплодник хорошо укореняется на любой почве, если отсутствует известь. На суглинистой, рыхлой почве он дает более яркий, пышный цвет как листьев, так и цветов. На скудной, песчаной почве, при своевременной подкормке его качества не теряются.

Регулярно поливать растение, но не чаще, чем 2 раза в неделю и хорошо дренировать.

Возможные болезни

Пузыреплодник Ред Барон очень устойчив к болезням и вредителям. Но для хорошего роста растению будет полезна гигиеническая обработка почвы весной бактериальными и противогрибковыми препаратами, такими как: Гамаир, Алирин, Фитоспорин.

Весной, при полном прогреве земли, необходимо добавить эти препараты в воду для полива. Дозировку рассчитывать по показаниям производителя. Одного полива будет достаточно на весь вегетативный сезон.

При большой скудости почвы у пузыреплодника может развиться пороз. Его проявления заметны сразу, молодые листья и побеги приобретают неестественный ржавый цвет и сохнут.

Устранить причину помогает препарат Филат железа и Фиролитам. Пороз у растения возникает из-за недостатка в почве железа. Поливка в корень железосодержащих препаратов быстро восстанавливает здоровье.

Для того чтобы снять химический стресс, полученный в результате обработки и поднять иммунитет растения используют антистрессовые препараты, такие как Экогель или Алирин.

Подкормка куста

Удобрять растение следует два раза в году. Использовать прикорм следующего состава:

Весной:

  • 500 мл. коровяка.
  • 25 мл. аммиачной селитры.
  • 25 мл. мочевины.
  • 10 л. воды.

Осенью:

  • 500 мл. коровяка.
  • 25 мл. мочевины.
  • 25 мл. аммиачной селитры.
  • 50 мл. нитрата фосфора.
  • 10 л. воды.

Состав хорошо перемешать, расчет полива такой же как и весной.

Селитра аммиачная
Мочевина
Коровяк

Размножение пузырепложника

Размножение Ред Барона можно произвести вегетативно (), делением куста и семенем.

Отводкой

Это самый простой и эффективный способ размножить растение.

Как это сделать:

  1. Весной, после появления первых листьев выбрать на взрослом кусте молодую и сильную ветку.
  2. Удалить с нее нижние листья.
  3. На нужном расстоянии подготовить яму глубиной до 15 см.
  4. Уложить ветку в яму, осторожно ее согнув, пришпилить деревянными или железными скобами.
  5. Засыпать яму землей или смесью земли с торфом.
  6. Обильно полить.
  7. До осени контролировать
    своевременный полив и рыхление почвы.
  8. В октябре отделить отводку от куста, пересадить на выбранное место и укрыть на зиму.
Ред Барон дает выбор из нескольких способов размножения

Черенками

  1. Перед выбросом цвета срезать молодые побеги длиной до 20 см., с обязательными двумя-тремя почечными междоузлиями.
  2. Удалить с нижней части черенка все листья, оставшиеся укоротить наполовину.
  3. Замочить в растворе Корневина на 2-3 дня, до появления первых признаков будущего корня.
  4. Высадить в питательную почву. Почва для высадки черенков такого же состава, как и при посадке в грунт.
  5. Укрыть саженцы пленкой. Регулярно поливать и проветривать. К осени черенок сформирует нужную корневую систему.
  6. На зиму черенок укрыть. Пересадить на новое место весной.

Деление куста

Самый быстрый способ размножения и одновременно трудоемкий, т.к. взрослый куст может иметь достаточно развитую корневую систему.

Производить деление куста быстро, чтобы у растения не подсыхали корни:

  1. Оголить полностью корень с той стороны, откуда планируете отрезать половину.
  2. Отделить нужную часть куста, отрубив корень лопатой или любым другим острым инструментом.
  3. Высадить растение в подготовленную яму. Засыпать питательной смесью.
  4. Полить раствором Корневина.
  5. Оставшийся куст подпитать Корневином.

Размножать пузыреплодник семенами в домашних условиях очень сложно и нецелесообразно. Поскольку Ред Барон находится в культуре не так давно, то через размножение семенем он теряет ряд декоративных качеств.

Обрезка

Ред Барон очень быстро растет и нуждается в обрезке. Если Вы хотите сохранить естественный, раскидистый рост веток потребуется санитарная обрезка весной.

Санитарная

Весной, до прогрева почвы срезают обломанные, мерзлые ветки, а так же побеги, растущие внутрь. Осенью, когда куст сбросил листву, его осматривают, обрезают лишние и сухие ветки.

Места срезов крупных побегов можно обработать садовым варом.

Формирующая

С пузыреплодника можно сформировать любую форму, круглую, квадратную, в форме фонтана.

Если садовод хочет получить куст с обильной листвой, которая благодаря своей красоте и цвету заменит цветы, обрезать следует ветки второго-третьего года и оставлять прошлогодние. Их легко отличить.

Годовые побеги весной выглядят почти черными, глянцевыми. Оставлять нужно хорошо перезимовавшие ветки. Они не дадут цветка, но принесут обильную листву.

Для обрезки рекомендуют использовать острые и чистые инструменты

Ветки, возраст которых два и более года, белесые, толще, на них хорошо заметны почки. Кора у взрослых веток может отслаиваться – это особенность вида. Эти ветви обязательно дадут много цветков.

Если предпочтение отдается цветку, то их следует сохранить, удаляя молодые побеги.

Омолаживающая обрезка пузыреплодника производится на 6 году. Куст обрезают на пень в октябре.

Уход зимой

Сорт Ред Барон морозоустойчив, хорошо переносит морозы до 10С. Если зима предполагается очень холодной, то куст лучше укрыть:

  • С наступлением первых холодных ночей куст осторожно стянуть шпагатом.
  • Обложить околоствольный круг торфом или стружкой.
  • Накрыть колпаком из рубероида. Можно использовать любой другой натуральный утеплитель.
  • Молодые экземпляры и саженцы всегда укрывать на зиму.

Ред барон

Сорт пузыреплодника Ред Барон считается самым ценным среди более чем 25 сортов растения. Его цветок достигает в диаметре 25-50 мм.

Ред Барон относится к калинолистному виду, он был привезен в Европу с Северной Америки, где он обычно растет у берегов рек. Ярко красный куст вырастает до 2-х метров. Листья пятилопастные, похожи на листья калины. Ствол бордовый.

Калинолистный пузыреплодник

Цвести пузыреплодник начинает в начале лета, выбрасывая белые с розовым отливом цветы. После цветения, к середине лета формируется плод. Гроздь состоит из 3-5 остроконечных мешочков.

В начале созревания плоды зеленые, постепенно краснеющие. К осени плоды приобретают блестящий красно-бордовый цвет.

Живая изгородь

Куст пузыреплодника образует широкое и плотное естественное ограждение. Благодаря быстрому росту с кустов можно легко сформировать прямоугольную или квадратную форму.

Часто растение высаживают плотным рядом у основания сеточного или проволочного забора. За сезон кусты разрастаются и полностью скрывают ограду.

Пузыреплодник хорошо высаживать в городах для озеленения дворов, улиц, аллей как живая изгородь.

Высаженный у железного забора пузыреплодник нужно всегда утеплять на зиму.

Сорта

Ред Барон часто называют благодарным растением из-за его стойкости к резким перепадам температур. Болезни редко поражают пузыреплодник, а такие вредители как гусеница, тля и жук предпочитают питаться другими растениями.

Выращивать растение в саду просто, уход за ним минимальный. Пузыреплодник, кроме сорта Ред Барон знаменит такими сортами:

Амурский вид

Лютеус Куст до 3-х метров с ярко желтыми листьями, которые с наступлением осени темнеют
Аурео Маргината Сорт имеет зеленые листья с золотым ободом
Нана Сорт-карлик амурского вида, вырастает до 1,5 м. Имеет ярко зеленый лист

Краснолистный или калинолистный вид

Дьяболо. Сорт калинолистного (краснолистного) пузыреплодника до 3-х метров высоты. Листья имеет красные или бордовые. Цветы всех растений белые, белые с розовым отливом или бледно-розовые.

Разнообразие сортов пузыреплодника дает полное право назвать этот куст листоцветущим.

Сорт Лютеус
Сорт Дьяболо

Яркость красок, которые отличают его от других кустарников на самом деле поразительна. Используя растение и для озеленения и для красоты, садоводы получают и наслаждение и экономию средств, т.к. саженцы растения сравнительно недороги.

Пузыреплодник калинолистный Ред Барон — описание, фото, посадка и уход

Автор Мария На чтение 4 мин. Просмотров 1.3k. Опубликовано

Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron) — декоративный, быстро растущий кустарник с яркими листьями и стволом.

Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron)декоративный, быстро растущий кустарник с яркими листьями и стволом. Весной покрывается контрастными белыми соцветиями, к осени на их месте формируются кисти плодов, которые являются украшением почти всю зиму. Используется пузыреплодник как одиночный декоративный элемент сада, живая изгородь, неприхотлив, устойчив к резким переменам погоды.

Характеристика и описание

Пузыреплодник Ред Барон в диком виде встречается по берегам озер и рек в Северной Америке. Поэтому сажать его лучше на в меру увлажненной земле и не допускать чрезмерного пересушивания почвы. Кустарник хоть и устойчив к засухе, но быстро теряет свою декоративность.

Детали Описание
Размер растения Высотой и шириной куст может быть до 2 м.
Крона Округлой формы, без стрижки приобретает неряшливость. Можно формировать по-разному, особенно в густых посадках живой изгороди.
Скорость роста Быстрорастущий.
Цветки\плоды Весной формируются плотные, пышные соцветия бело-розовых цветков. Плоды сборные, в форме вздутых красных листовок, украшают куст с августа до глубокой зимы.
Листья Образуют от 3 до 5 лопастей, хорошо «прорисованных», умеренно острых на концах. Размером до 10 см., по краю пильчато-зубчатые. Цвет листа от интенсивно-красного до глубоко-бордового. Осенью становятся бронзовыми.
Отношение к свету Выносит полутень, нежелательно соседство с высокими деревьями, постройками, полностью закрывающими солнце.
Зимостойкость Выдерживает умеренные морозы, максимум – до минус 25-30 С.

Не рекомендуется сажать пузыреплодник в тени, листья полностью утрачивают декоративный окрас и становятся почти зелеными. Запах при цветении не сильный, куст можно сажать в саду, рядом с домом.

Посадка, выращивание и уход

Посадка пузыреплодника калинолистного Ред Барон начинается с осмотра земли, участка. Почва под кустарником должна быть умеренно дренированная, увлажненная, насыщенная перегноем. Лучше всего, если место будет солнечное с периодическим, но не сильным затенением в течение дня. Так листовая пластина пузыреплодника раскроет свой насыщенный свет, а в тени лист останется простым, зеленым.

Главные условия:

  • Кислотность почвы – предпочтительно pH 5-6.0.
  • Рыхлость земли.
  • Застой воды корни пузыреплодника не любят.
  • Минимум извести.
  • Своевременное внесение азотистых и фосфорных удобрений.

Сажаютрастение весной, хотя оно прекрасно приживается в течение всего теплого сезона. Уход заключается в систематическом формировании кроны, удалении старых, грубых и больных ветвей.

Если «Ред Барон» приобретают для создания живой изгороди, то саженцы высаживают в шахматном порядке. Расстояние между кустами 30-40 см.

В качестве подкормок используют навоз, мочевину, аммиачную селитру и нитрат фосфора. Аммиаксодержащие удобрения способствуют наращиванию зеленой массы (листьев), а калий-фосфорные удобрения нужны для обильного цветения.

Размножают пузыреплодник Ред Барон при помощи черенкования, отводками, делением куста или семенами. Отводками куст размножается очень быстро, достаточно пригнуть побег к земле и зафиксировать его в почве. Укоренившийся побег обрезают и высаживают на новое место.

Болезни и вредители

Пузыреплодник Ред Барон устойчив к основным садовым заболеваниям, чаще страдает от неправильного ухода, чем от вредителей. Главная проблема – хлороз, который характеризуется пожелтением листа и возникает из-за нехватки в почве железа, магния, азота. Если есть хлороз достаточно скорректировать внесение удобрений.

Чтобы укрепить иммунитет растения, обеспечить его лучшую приживаемость и выживаемость, используют Эпин-экстра, Экогель. 

От грибковых поражений и коррозии применяют Фитоспорин. Бактериальные препараты Гамаир, Алирин применяют вкупе, они безвредны.

Использование в ландшафтном дизайне

Red Baron ценится ландшафтными дизайнерами и садоводами за необычайную окраску листьев, контраст их со цветами, поэтому пузыреплодник используют именно для контрастных посадок. При правильной обрезке он может выступать солитером, стать ярким дополнением для низкорослых цветов.

Красные листья пузыреплодника Ред Барон отлично сочетаются с зелеными, поэтому его высаживают в смеси с другими кустарниками, предназначенными для формирования живой изгороди. Большим плюсом станет изменение цветовой гаммы растения в течение весенне-осеннего сезона.


Растение хорошо переносит загазованность воздуха, кустарник высаживают вдоль дорог, трасс или в парках города. С его помощью можно снизить проникновение грязи и пыли на детские площадки, придомовые территории.

В саду, если пузыреплодник Ред Барон правильно стричь, он будет привлекать внимание красно-бордовыми листьями по краям дорожек, возле входа, беседок или изгородей. С его помощью можно скрыть недостатки участка, визуально «выровнять» поверхность и придать нужную симметрию.

Пузыреплодник ред барон — все от посадки до ландшафтного дизайна — sdelayzabor.ru

Пузыреплодник калинолистный под названием «Red Baron» относится к числу самых интересных селекционных сортов. В средней полосе России он является излюбленным растением садоводов и владельцев питомников. Он хорошо переносит суровую зиму и засушливое лето, с благодарностью реагирует на своевременный, хотя и минимальный, уход. Кустарник все свои декоративные качества раскрывает на открытых солнечных участках сада. Ред барон хорошо растет и в полутени, но его листочки при этом теряют свой пурпурный окрас, становясь зелеными. Растение имеет и другие интересные особенности.

Пузыреплодник ред барон

Пузыреплодник ред барон — секреты декоративности

Этот сорт пузыреплодника декоративен во всем: листве, стеблях, цветах, плодах. Трехлопастная форма листьев схожа с формой листьев калины. Гофрированная листва имеет красивый пурпурный оттенок, который к осени становится более темным, бронзовым.

Шикарная густая крона образуется длинными побегами, изогнутыми дугой. Кора красно-коричневого цвета практически сливается с цветом листвы. Кульминацией декоративности считается время цветения калинолистного пузыреплодника red baron. Обычно к середине июня все кустарники уже отцветают. А вот этот сорт только начинают украшать розово-белые соцветия, состоящие из множества мелких цветочков. На фоне других растений «Ред барон» эффектно солирует. А поскольку он отлично переносит условия города, его можно встретить в парках, скверах, на улицах и в садах.

К осени на раскидистой кроне этого калинолистного пузыреплодника появляются удивительные плоды. Они имеют форму вздутых коробочек. При надавливании они издают звук, похожий на схлопывание пузыря. Отсюда произошло и название этого растения. Их цвет в процессе созревания и высыхания постепенно меняется от розовато-красного до рыжевато-бурого.

Не смотря на то, что полюбившийся всем кустарник, имеющий американское происхождение, можно встретить даже в палисадниках у сельских бабушек, не многие знают, как он называется. В народе за особенность сбрасывать кору во время вегетации его прозвали «бесстыдник». Старая кора отходит тонкими пластинками, а по всей длине побегов в это время уже просматривается нежная молодая кожица.

Особенности выращивания и правила ухода

Особенности посадки ред барона калинолистного практически ничем не отличаются от посадки других сортов пузыреплодника. Место для этого растения выбирают солнечное, чтобы листва проявила все свои декоративные качества. Ред барон калинолистный хорошо растет и в тени, но листочки при этом становятся зелеными. Кустарник будет выглядеть очень обыденно.

Выбирают молодые саженцы с открытой корневой системой ранней весной или осенью, до наступления первых заморозков. Внешний вид саженца расскажет о его здоровье. Корни перед началом посадки необходимо замочить в воде на два – три часа, чтобы они не были слишком сухими. Растения из контейнеров можно высаживать весь сезон.

Посадочные ямы роют на глубину 60 сантиметров, куда насыпают питательный грунт. Ред барон не предъявляет особых требований к состоянию почвы, но нуждается в хорошем дренажном слое. После посадки почву вокруг саженцев нужно хорошо утрамбовать и обильно полить.

Быстрорастущий кустарник обычно хорошо переносит сильные морозы. Но молоденькие побеги и верхушки старых ветвей могут вымерзать. Поэтому ранней весной нужно обязательно делать санитарную обрезку. Сорт пузыреплодника ред барон стригут также с целью придания какой-либо садовой формы. Это хорошо отражается на росте и дальнейшем развитии кустарника.

Растение хорошо переносит засуху, а вот от застоя влаги может погибнуть. Правила ухода за ним достаточно просты: своевременная обрезка, подкормка, достаточно редкий полив, рыхление почвы и удаление сорняков. К болезням и вредителям этот вид пузыреплодника очень устойчив. Однако, профилактическая обработка позволит избежать возможных проблем.

Быстрорастущее растение в течение 1 – 2 лет заполнит невыгодные пустоты в вашем саду. Высота кустарника может достигать 2 – 3 метров. Диаметр кроны такой же.

Размножают этот сорт пузыреплодника делением куста, отводками или черенками. Выращивание семенами не рекомендуется, поскольку молодые саженцы не возьмут все декоративные качества материнского растения.

Использование в ландшафтном дизайне

Роскошный внешний вид кустарника и его неприхотливость делают его излюбленным материалом специалистов по ландшафтному дизайну. Его можно встретить как на улицах города, так и в небольших поселках, на дачных участках. Он может быть элементом дизайна парадных входов и мест для проведения торжественных мероприятий.

Ред барон часто используют в сложных садовых композициях, где он может солировать, а также являться прекрасным фоном для цветов. Кустарник отлично выполняет роль солитера в подлесках на фоне хвойных и лиственных посадок.

Из этого вида пузыреплодника получаются шикарные, плотные живые изгороди, которые становятся настоящим украшением любого сада, дачного участка или какой-либо зоны отдыха. К тому же ухаживать за такой изгородью одно удовольствие. Работа не занимает много времени, а результат еще долго радует.

Кустарник отлично смотрится в одиночной или групповой посадке на газоне. Если его сочетать с другими видами растений и придать с помощью стрижки какую-либо садовую форму, то эффект будет просто потрясающий.

Пузыреплодник калинолистный Red Baron

(Physocarpus opulifolius «Red Baron»)

Плотный куст с многочисленными прямыми побегами, образующими густую, полушаровидную крону. Листья 3-5 лопастные (до 7см), гофрированные по жилкам, вытянутые, уже, чем у Диабло, темно–красные, в полной тени — зеленые с небольшим красноватым оттенком, осенью – бронзовые.

Цветы многочисленные, бледно-розовые, собранные в щитках (до5см), цветение с начала-середины июня (2- 3 недели). Плоды — сборные (вздутые листовки), красные.

Предпочитает солнечные места, выносит полутень и тень, теряя только интенсивность окрашивания. К почве не требователен, но предпочитает суглинистые кислые. Не выносит застоя влаги. Хорошо переносит городскую загрязненность. Морозостоек, но могут подмерзать молодые побеги. Абсолютно неприхотливое, очень эффектное и быстрорастущее растение. Прекрасно сохраняет свою яркую окраску на солнечных местах. В тенистых – зеленеет, в зависимости от степени освещенности. Изредка появляющиеся зеленые побеги необходимо вырезать полностью. Уход заключается в периодических поливах, подкормках, рыхлении почвы и в обрезке старых побегов.

Лучше всего пузыреплодник размножается вегетативным путем: делением куста, черенками и отводками. Семенами размножать не рекомендуется, поскольку не все сеянцы имеют такой же яркий цвет листвы, как у родительского растения. Чаще всего производят деление разросшегося куста, лучше это делать весной, или зеленое черенкование – наиболее легкий способ для получения качественного посадочного материала. Черенки с куста срезают начиная со второй половины лета. Укоренять их лучше всего в специально подготовленной теплице, разместив ее в тенистом месте сада. Укоренённые черенки на зиму обязательно надо укрывать. На следующий год успешно перезимовавшие растения можно высаживать на постоянное место.

Результат дальнейшей селекции пузыреплодников — Ред Барон отличается от Диабло менее интенсивной окраской фактурных листьев, меньшими и компактными размерами. Благодаря этому, может быть использован в тех композициях, где Диабло либо слишком велик, либо агрессивно темный. Декоративен в течение всего вегетационного периода своей листвой, цветами и плодами. Из-за своих декоративных качеств и, особенно, высокой неприхотливости и стойкости в городских условиях, рекомендован для широкого применения в озеленении города и частных садов. Пузыреплодник Ред Барон способен в течение 2-3 лет закрыть проблемные места, создать яркий элемент в сложных контрастных композициях. Живые изгороди из него очень красивые, плотные и легкие в уходе.

Пузыреплодник ред барон посадка и уход в открытом грунте

Среди множества декоративных кустарников пузыреплодник Ред Барон занимает особое место. Никого не оставляет равнодушным раскидистый куст с ярко-красными, блестящими листьями, покрывающийся в начале лета большими бело-розовыми цветами. Сорт имеет высоту до 2-х. метров, и сохраняет окраску листьев в течении всего теплого периода.

Уход за пузыреплодником

Уход за растением не требует специальной подготовки. Хорошо растет на почвах разного состава, не теряет яркости листа в городских условиях. Переносит загрязненный автомобильными выбросами воздух.

Городские выхлопные газы растению не страшны

На открытых, солнечных участках листья пузыреплодника ярко-красные, образуют густую, плотную крону.

В полутени цвет сохраняется. В тенистых местах листья Ред Барона приобретают бурый оттенок в верхней части и зеленый внизу.

Несмотря на неприхотливость растения, нужно соблюдать необходимые условия, позволяющие пузыреплоднику хорошо расти.

Полив Обязательный полив, в жаркое время 2-3 раза в неделю
Рыхление Регулярно рыхлить почву около стволов. Соблюдать осторожность, чтобы не повредить корни
Обрезка Два раза в год проводить обрезку
Подкормка Весной и осенью осуществлять подкормку
Обработка почвы Весной проводить санитарную обработку почвы вокруг растения

Высадка в открытом грунте

Высаживают саженцы в открытый грунт весной или осенью (апрель, октябрь). Если саженец имеет закрытые корни, т.е. сажается с комом земли на корнях, посадить его можно и летом. Подготовка ямы для саженца не занимает много времени.

  • Выкапываете яму достаточной глубины.
  • Выложить слой питательной почвы на дно.
  • Установить саженец и присыпать землей, смешанной с питательной почвой.
  • Питательная почва содержит в себе смесь равных долей: песок, торф, дерн, земля.

Как и с другими цветами, оптимальная почва – это сочетание нескольких компонентов

Ветки ствола должны быть закопаны в землю не более чем на 1-2 см. После усадки земли через пару дней, добавить землю сверху до ровной поверхности. Не окучивать.

При посадке молодого саженца удобрений не добавлять. Растение будет проходить естественную адаптацию и не сможет усвоить дополнительный прикорм.

После посадки пузыреплодник обильно полить. Через три-четыре дня произвести первое рыхление почвы.

Прикорневую зону обложить торфом для сохранения влаги.

В почве, на которую высаживают куст, не должно быть извести.

Пузыреплодник хорошо укореняется на любой почве, если отсутствует известь. На суглинистой, рыхлой почве он дает более яркий, пышный цвет как листьев, так и цветов. На скудной, песчаной почве, при своевременной подкормке его качества не теряются.

Регулярно поливать растение, но не чаще, чем 2 раза в неделю и хорошо дренировать.

Возможные болезни

Пузыреплодник Ред Барон очень устойчив к болезням и вредителям. Но для хорошего роста растению будет полезна гигиеническая обработка почвы весной бактериальными и противогрибковыми препаратами, такими как: Гамаир, Алирин, Фитоспорин.

Весной, при полном прогреве земли, необходимо добавить эти препараты в воду для полива. Дозировку рассчитывать по показаниям производителя. Одного полива будет достаточно на весь вегетативный сезон.

При большой скудости почвы у пузыреплодника может развиться пороз. Его проявления заметны сразу, молодые листья и побеги приобретают неестественный ржавый цвет и сохнут.

Устранить причину помогает препарат Филат железа и Фиролитам. Пороз у растения возникает из-за недостатка в почве железа. Поливка в корень железосодержащих препаратов быстро восстанавливает здоровье.

Для того чтобы снять химический стресс, полученный в результате обработки и поднять иммунитет растения используют антистрессовые препараты, такие как Экогель или Алирин.

Подкормка куста

Удобрять растение следует два раза в году. Использовать прикорм следующего состава:

Весной:

  • 500 мл. коровяка.
  • 25 мл. аммиачной селитры.
  • 25 мл. мочевины.
  • 10 л. воды.

Осенью:

  • 500 мл. коровяка.
  • 25 мл. мочевины.
  • 25 мл. аммиачной селитры.
  • 50 мл. нитрата фосфора.
  • 10 л. воды.

Состав хорошо перемешать, расчет полива такой же как и весной.

Размножение пузырепложника

Размножение Ред Барона можно произвести вегетативно (), делением куста и семенем.

Отводкой

Это самый простой и эффективный способ размножить растение.

Как это сделать:

  1. Весной, после появления первых листьев выбрать на взрослом кусте молодую и сильную ветку.
  2. Удалить с нее нижние листья.
  3. На нужном расстоянии подготовить яму глубиной до 15 см.
  4. Уложить ветку в яму, осторожно ее согнув, пришпилить деревянными или железными скобами.
  5. Засыпать яму землей или смесью земли с торфом.
  6. Обильно полить.
  7. До осени контролировать своевременный полив и рыхление почвы.
  8. В октябре отделить отводку от куста, пересадить на выбранное место и укрыть на зиму.

Ред Барон дает выбор из нескольких способов размножения

Черенками

  1. Перед выбросом цвета срезать молодые побеги длиной до 20 см., с обязательными двумя-тремя почечными междоузлиями.
  2. Удалить с нижней части черенка все листья, оставшиеся укоротить наполовину.
  3. Замочить в растворе Корневина на 2-3 дня, до появления первых признаков будущего корня.
  4. Высадить в питательную почву. Почва для высадки черенков такого же состава, как и при посадке в грунт.
  5. Укрыть саженцы пленкой. Регулярно поливать и проветривать. К осени черенок сформирует нужную корневую систему.
  6. На зиму черенок укрыть. Пересадить на новое место весной.

Деление куста

Самый быстрый способ размножения и одновременно трудоемкий, т.к. взрослый куст может иметь достаточно развитую корневую систему.

Производить деление куста быстро, чтобы у растения не подсыхали корни:

  1. Оголить полностью корень с той стороны, откуда планируете отрезать половину.
  2. Отделить нужную часть куста, отрубив корень лопатой или любым другим острым инструментом.
  3. Высадить растение в подготовленную яму. Засыпать питательной смесью.
  4. Полить раствором Корневина.
  5. Оставшийся куст подпитать Корневином.

Размножать пузыреплодник семенами в домашних условиях очень сложно и нецелесообразно. Поскольку Ред Барон находится в культуре не так давно, то через размножение семенем он теряет ряд декоративных качеств.

Обрезка

Ред Барон очень быстро растет и нуждается в обрезке. Если Вы хотите сохранить естественный, раскидистый рост веток потребуется санитарная обрезка весной.

Санитарная

Весной, до прогрева почвы срезают обломанные, мерзлые ветки, а так же побеги, растущие внутрь. Осенью, когда куст сбросил листву, его осматривают, обрезают лишние и сухие ветки.

Места срезов крупных побегов можно обработать садовым варом.

Формирующая

С пузыреплодника можно сформировать любую форму, круглую, квадратную, в форме фонтана.

Если садовод хочет получить куст с обильной листвой, которая благодаря своей красоте и цвету заменит цветы, обрезать следует ветки второго-третьего года и оставлять прошлогодние. Их легко отличить.

Годовые побеги весной выглядят почти черными, глянцевыми. Оставлять нужно хорошо перезимовавшие ветки. Они не дадут цветка, но принесут обильную листву.

Для обрезки рекомендуют использовать острые и чистые инструменты

Ветки, возраст которых два и более года, белесые, толще, на них хорошо заметны почки. Кора у взрослых веток может отслаиваться — это особенность вида. Эти ветви обязательно дадут много цветков.

Если предпочтение отдается цветку, то их следует сохранить, удаляя молодые побеги.

Омолаживающая обрезка пузыреплодника производится на 6 году. Куст обрезают на пень в октябре.

Уход зимой

Сорт Ред Барон морозоустойчив, хорошо переносит морозы до 10С. Если зима предполагается очень холодной, то куст лучше укрыть:

  • С наступлением первых холодных ночей куст осторожно стянуть шпагатом.
  • Обложить околоствольный круг торфом или стружкой.
  • Накрыть колпаком из рубероида. Можно использовать любой другой натуральный утеплитель.
  • Молодые экземпляры и саженцы всегда укрывать на зиму.

Ред барон

Сорт пузыреплодника Ред Барон считается самым ценным среди более чем 25 сортов растения. Его цветок достигает в диаметре 25-50 мм.

Ред Барон относится к калинолистному виду, он был привезен в Европу с Северной Америки, где он обычно растет у берегов рек. Ярко красный куст вырастает до 2-х метров. Листья пятилопастные, похожи на листья калины. Ствол бордовый.

Калинолистный пузыреплодник

Цвести пузыреплодник начинает в начале лета, выбрасывая белые с розовым отливом цветы. После цветения, к середине лета формируется плод. Гроздь состоит из 3-5 остроконечных мешочков.

В начале созревания плоды зеленые, постепенно краснеющие. К осени плоды приобретают блестящий красно-бордовый цвет.

Живая изгородь

Куст пузыреплодника образует широкое и плотное естественное ограждение. Благодаря быстрому росту с кустов можно легко сформировать прямоугольную или квадратную форму.

Часто растение высаживают плотным рядом у основания сеточного или проволочного забора. За сезон кусты разрастаются и полностью скрывают ограду.

Пузыреплодник хорошо высаживать в городах для озеленения дворов, улиц, аллей как живая изгородь.

Высаженный у железного забора пузыреплодник нужно всегда утеплять на зиму.

Сорта

Ред Барон часто называют благодарным растением из-за его стойкости к резким перепадам температур. Болезни редко поражают пузыреплодник, а такие вредители как гусеница, тля и жук предпочитают питаться другими растениями.

Выращивать растение в саду просто, уход за ним минимальный. Пузыреплодник, кроме сорта Ред Барон знаменит такими сортами:

Амурский вид

Лютеус Куст до 3-х метров с ярко желтыми листьями, которые с наступлением осени темнеют
Аурео Маргината Сорт имеет зеленые листья с золотым ободом
Нана Сорт-карлик амурского вида, вырастает до 1,5 м. Имеет ярко зеленый лист

Краснолистный или калинолистный вид

Дьяболо. Сорт калинолистного (краснолистного) пузыреплодника до 3-х метров высоты. Листья имеет красные или бордовые. Цветы всех растений белые, белые с розовым отливом или бледно-розовые.

Разнообразие сортов пузыреплодника дает полное право назвать этот куст листоцветущим.

Яркость красок, которые отличают его от других кустарников на самом деле поразительна. Используя растение и для озеленения и для красоты, садоводы получают и наслаждение и экономию средств, т.к. саженцы растения сравнительно недороги.

Пузыреплодник калинолистный под названием «Red Baron» относится к числу самых интересных селекционных сортов. В средней полосе России он является излюбленным растением садоводов и владельцев питомников. Он хорошо переносит суровую зиму и засушливое лето, с благодарностью реагирует на своевременный, хотя и минимальный, уход. Кустарник все свои декоративные качества раскрывает на открытых солнечных участках сада. Ред барон хорошо растет и в полутени, но его листочки при этом теряют свой пурпурный окрас, становясь зелеными. Растение имеет и другие интересные особенности.

Пузыреплодник ред барон

Пузыреплодник ред барон — секреты декоративности

Этот сорт пузыреплодника декоративен во всем: листве, стеблях, цветах, плодах. Трехлопастная форма листьев схожа с формой листьев калины. Гофрированная листва имеет красивый пурпурный оттенок, который к осени становится более темным, бронзовым.

Шикарная густая крона образуется длинными побегами, изогнутыми дугой. Кора красно-коричневого цвета практически сливается с цветом листвы. Кульминацией декоративности считается время цветения калинолистного пузыреплодника red baron. Обычно к середине июня все кустарники уже отцветают. А вот этот сорт только начинают украшать розово-белые соцветия, состоящие из множества мелких цветочков. На фоне других растений «Ред барон» эффектно солирует. А поскольку он отлично переносит условия города, его можно встретить в парках, скверах, на улицах и в садах.

К осени на раскидистой кроне этого калинолистного пузыреплодника появляются удивительные плоды. Они имеют форму вздутых коробочек. При надавливании они издают звук, похожий на схлопывание пузыря. Отсюда произошло и название этого растения. Их цвет в процессе созревания и высыхания постепенно меняется от розовато-красного до рыжевато-бурого.

Не смотря на то, что полюбившийся всем кустарник, имеющий американское происхождение, можно встретить даже в палисадниках у сельских бабушек, не многие знают, как он называется. В народе за особенность сбрасывать кору во время вегетации его прозвали «бесстыдник». Старая кора отходит тонкими пластинками, а по всей длине побегов в это время уже просматривается нежная молодая кожица.

Особенности выращивания и правила ухода

Особенности посадки ред барона калинолистного практически ничем не отличаются от посадки других сортов пузыреплодника. Место для этого растения выбирают солнечное, чтобы листва проявила все свои декоративные качества. Ред барон калинолистный хорошо растет и в тени, но листочки при этом становятся зелеными. Кустарник будет выглядеть очень обыденно.

Выбирают молодые саженцы с открытой корневой системой ранней весной или осенью, до наступления первых заморозков. Внешний вид саженца расскажет о его здоровье. Корни перед началом посадки необходимо замочить в воде на два – три часа, чтобы они не были слишком сухими. Растения из контейнеров можно высаживать весь сезон.

Посадочные ямы роют на глубину 60 сантиметров, куда насыпают питательный грунт. Ред барон не предъявляет особых требований к состоянию почвы, но нуждается в хорошем дренажном слое. После посадки почву вокруг саженцев нужно хорошо утрамбовать и обильно полить.

Быстрорастущий кустарник обычно хорошо переносит сильные морозы. Но молоденькие побеги и верхушки старых ветвей могут вымерзать. Поэтому ранней весной нужно обязательно делать санитарную обрезку. Сорт пузыреплодника ред барон стригут также с целью придания какой-либо садовой формы. Это хорошо отражается на росте и дальнейшем развитии кустарника.

Растение хорошо переносит засуху, а вот от застоя влаги может погибнуть. Правила ухода за ним достаточно просты: своевременная обрезка, подкормка, достаточно редкий полив, рыхление почвы и удаление сорняков. К болезням и вредителям этот вид пузыреплодника очень устойчив. Однако, профилактическая обработка позволит избежать возможных проблем.

Быстрорастущее растение в течение 1 – 2 лет заполнит невыгодные пустоты в вашем саду. Высота кустарника может достигать 2 – 3 метров. Диаметр кроны такой же.

Размножают этот сорт пузыреплодника делением куста, отводками или черенками. Выращивание семенами не рекомендуется, поскольку молодые саженцы не возьмут все декоративные качества материнского растения.

Использование в ландшафтном дизайне

Роскошный внешний вид кустарника и его неприхотливость делают его излюбленным материалом специалистов по ландшафтному дизайну. Его можно встретить как на улицах города, так и в небольших поселках, на дачных участках. Он может быть элементом дизайна парадных входов и мест для проведения торжественных мероприятий.

Ред барон часто используют в сложных садовых композициях, где он может солировать, а также являться прекрасным фоном для цветов. Кустарник отлично выполняет роль солитера в подлесках на фоне хвойных и лиственных посадок.

Из этого вида пузыреплодника получаются шикарные, плотные живые изгороди, которые становятся настоящим украшением любого сада, дачного участка или какой-либо зоны отдыха. К тому же ухаживать за такой изгородью одно удовольствие. Работа не занимает много времени, а результат еще долго радует.

Кустарник отлично смотрится в одиночной или групповой посадке на газоне. Если его сочетать с другими видами растений и придать с помощью стрижки какую-либо садовую форму, то эффект будет просто потрясающий.

Среди большого количества декоративных растений только некоторые могут похвастаться абсолютной неприхотливостью и высокой декоративностью. К таким растениям относится и пузыреплодник калинолистный.

Выращивают это растение из-за его эффектного вида: шаровидная густая крона из раскидистых поникающих ветвей с крупными гофрированными листьями выглядит пышно сверху донизу.

Цветущий пузыреплодник

Посадка пузыреплодника

Растение терпимо относится к тени, но окрас листьев со временем при затенении блекнет, поэтому желательно этот кустарник высаживать на открытом и солнечном месте. К почве у кустарника всего два условия – отсутствие извести и наличие дренажа. Конечно же, более пышный вид у пузыреплодника будет на плодородной, рыхлой и свежей почве, но и на субстрате, бедном питательными веществами, он также будет выглядеть неплохо. Еще одним достоинством этого растения можно считать  его устойчивость к загазованности воздуха, поэтому его можно спокойно высаживать рядом с дорогами.

Для посадки

пузыреплодника

семена желательно не использовать, так как свой оригинальный окрас листьев растение передает только части потомства. Лучше всего для первоначальной посадки приобрести в питомниках или садовых центрах растения с закрытой корневой системой, то есть выращенные в специальных контейнерах. Такие кусты можно высаживать в любой период вегетативного сезона (весной, летом или осенью). Для посадки необходимо выкопать яму глубиной и диаметром в 50 см, на дно которой добавляется садовый грунт на торфяной основе или

перегной

.

Посадка пузыреплодника  

В дальнейшем куст пузыреплодника аккуратно достается из контейнера (главное при этом не повредить корневой ком и не расправлять его) и ставится в приготовленную посадочную яму. Затем яма засыпается плодородной почвой, а само растение желательно заглубить до 5 см – эта процедура поможет дать пузыреплоднику дополнительные побеги из спящих почек.

После этого обильно поливаем куст водой и раствором Корневина, как только вода впитается,

мульчируем

приствольный круг (для этого подойдет даже простая сухая земля). При такой обработке поверхностная корка не образуется и корни пузыреплодника смогут получить необходимое им количество воздуха.

Размножение пузыреплодника

Размножать пузыреплодник можно делением куста, отводками или черенкованием.

Размножение пузыреплодника отводками

Закладка отводков как способ размножения пузыреплодника, дает очень неплохие результаты. Для отводка необходимо выбрать здоровый и сильный побег, направленный наружу. С него удаляются практически все листья, оставляют только те, что на верхушке. Затем подготовленный побег укладываем в канавку (глубина канавки до 15 см) и пришпиливаем к земле (для этой цели отлично подойдут деревянные скобы).

Размножение пузыреплодника отводками. Фото с сайта agronomu.com Эту процедуру надо проводить в начале весеннего сезона, чтобы за оставшееся время до зимы отводок успел укорениться. Важно вовремя увлажнять почву в засушливые периоды – без увлажнения неокрепшие корни отводка могут погибнуть. В конце осеннего сезона молодые кусты пузыреплодника отделяются от материнского растения и укрываются на зиму.

Размножение пузыреплодника черенкованием

Для размножения пузыреплодника черенкованием необходимо использовать зеленые побеги, выросшие в текущем году. Отделенные побеги надо замочить в любом стимуляторе корнеобразования (например, в растворе того же Корневина) и высадить в субстрат песка с торфом или в речной песок.

Размножение пузыреплодника черенкованием. Фото с сайта agronomu.com После посадки поливаем черенки, затем укрываем их полиэтиленом. Если черенков мало, то можно укрыть каждый из них по отдельности пластиковыми бутылками с обрезанным горлышком. Последующий уход до зимнего сезона заключается в систематическом увлажнении и проветривании. С наступлением зимы укрываем укорененные черенки, а весной поросль пузыреплодника высаживаем на его постоянное место.

Уход за пузыреплодником

Пузыреплодник — растение в уходе неприхотливое, хотя некоторые особенности при этом присутствуют. Сам по себе кустарник живет до четверти века и в вегетативный период развивается быстрыми темпами. При хороших условиях за один год времени пузыреплодник способен прибавлять до 40 см как в высоту, так и в ширину. Поэтому для придания кусту нужной вам формы и стимуляции ветвления нужна тщательная обрезка.

Саму процедуру растение переносит стойко и безболезненно и в дальнейшем быстро обрастает молодыми побегами. Большой плюс кустарника — отличная зимостойкость, в средней полосе он зимует без укрытия, и только при сильных морозах могут повреждаться кончики побегов.

Семенные коробочки пузыреплодника сорта Luteus  

Обрезка 

Обрезка пузыреплоднику нужна как санитарная, так и кустоформирующая. Санитарная обрезка проводится в весенний период и состоит из обрезки поломанных и подмерзших ветвей. Ну а формирующая обрезка необходима для того чтобы куст не проказничал и рос так как вам требуется 🙂 Ее проводят также весной (до распускания почек на кусте) или осенью, после окончания вегетативного периода.

Так как большинство сортов пузыреплодника калинолистного выглядят фонтанообразно, то при правильной формирующей обрезке просыпаются и идут в рост верхние почки растения. Поэтому есть два основных варианта формирующей обрезки. Чтобы получить мощный и широкий куст с большим количеством стволов, обрезку проводим на высоте 40-50 см. А для придания кусту более выраженной фонтанообразной формы необходимо вырезать все тонкие побеги у основания куста, оставляя при этом до 5 наиболее крепких и мощных, которые, для стимуляции роста, также дополнительно обрезают на высоте 1,5 м.

Полив 

Частота полива кустов пузыреплодника зависит от вида почвы, климатической зоны, где растет кустарник и его возраста. Если в районе произрастания растения возможны высокие температуры летом и куст высажен на легких суглинистых почвах, то поливать растение необходимо с конца весеннего сезона до наступления осени.

При этом полив делают регулярно (как минимум 2 раза в неделю), выливая под взрослое растение до 40 л воды. Когда куст пузыреплодника растет на газонах или на тяжелой глинистой почве, возможна другая опасность – перелив. При избыточном увлажнении куст пузыреплодника легко поражается  мучнистой росой, а это может привести к гибели растения.

Подкормка 

Подкормку пузыреплодника проводят в весенний и осенний периоды: ранней весной

азотосодержащими удобрениями

, а осенью

минеральными

. Весной используют коровяк, мочевину и аммиачную селитру (из расчета на 10 л воды берем пол-литровую банку коровяка, столовую ложку аммиачной селитры и мочевины).

Осенью можно использовать нитроаммофоску (1 спичечный коробок на 10 л воды). Взрослым растениям  (10-20 лет) понадобится до 15 л раствора при подкормке.

Сорта пузыреплодника

Для декоративного украшения участка используют несколько сортов пузыреплодника калинолистного (

Physocarpus opulifolius

), которые обычно объединяют в две группы сортов: краснолистные и желтолистные.

К краснолистным относятся следующие сорта:

  • Пузыреплодник калинолистный Diablo

Вырастает до 3 м в высоту, листья глянцевые, пурпурно-красного оттенка. При посадке в затененном месте листва становится зеленой с чуть заметным пурпурным окрасом.

Пузыреплодник калинолистный, сорт Diablo  

  • Пузыреплодник калинолистный Summer Wine

Кусты этого сорта вырастают до 2 м в высоту. Весной у листвы окрас винно-красного цвета, который летом меняется на зеленый.

Пузыреплодник калинолистный Summer Wine. Фото с сайта rydlingeplantskola.se

  • Пузыреплодник калинолистный Red Baron 

Пузыреплодник «Ред Барон» радует розовыми цветами в момент цветения и красными ягодами в период их созревания. Вырастает до 2 м в высоту.

Пузыреплодник калинолистный Red Baron
К наиболее распространенным желтолистным сортам относятся следующие:

  • Пузыреплодник калинолистный Luteus

У пузыреплодника «Лютеус» высота кустов до 3 м, листья в тени зелено-желтого окраса, на открытых солнечных местах желтого оттенка.

Пузыреплодник калинолистный Luteus

  • Пузыреплодник калинолистный Dart’s Gold

Кусты этого сорта вырастают до 1,5 м, листья при распускании оранжево-желтого цвета, летом зеленые, а осенью желто-бронзового оттенка.

Пузыреплодни калинолистный Dart’s Gold. Фото с сайта flora-company.ru Пузыреплодник может отлично солировать или применяться в живых изгородях. Живая изгородь из пузыреплодника смотрится весьма декоративно, но требует постоянной обрезки и ухода. Зато она порадует вас меняющимися оттенками листвы в зависимости от сезона, красивыми цветами весной и красными ягодами осенью.

Как на городских клумбах, так и в частных палисадниках нередко можно заметить декоративное растение – пузыреплодник. Он имеет широкие и плоские листья различных цветов – от насыщенного зеленого до бордового. Пузыреплодник любят применять в ландшафтном дизайне благодаря его неприхотливости и холодостойкости, особенно такие его сорта, как «Ред барон», «Нанус», «Дартс Голд» и другие.

Пузыреплодник «Ред барон» – посадка и уход

«Ред барон» – один из наиболее интересных селекционных сортов пузыреплодника. Его название говорит само за себя: листья у этого растения имеют темно-красный цвет, а осенью приобретают бронзовый окрас. Что касается цветов пузыреплодника, то «Ред барон» отличается обильным цветением – куст этого растения буквально усыпан бледновато-розовыми некрупными цветками. Пузыреплодник этого сорта – плотный куст с густой кроной в форме полусферы (для этого его нужно своевременно стричь). Следует отметить, что «Барон» – эффектное растение, к тому же быстрорастущее. Пузыреплодник неплохо чувствует себя в городских условиях, он достаточно неприхотлив, растет и на солнце, и в полутени. Однако чем более затененное место вы выбрали для посадки, тем менее яркой будет листва у куста: в тени она обычно зеленеет.

Посадка калинолистного «Ред барона» ничем не отличается от прочих калинолистных пузыреплодников. Она производится весной (в идеале – до распускания листьев) либо осенью, в середине сентября. Корни перед посадкой желательно замочить на пару часов, а в посадочную яму 60 см глубиной – насыпать питательный грунт. К качеству и кислотности почвы пузыреплодник не требователен, но обратите внимание на необходимость в дренаже. После посадки растение хорошо полейте, а почву – утрамбуйте.

Данный сорт отличается своей морозостойкостью, однако верхушки веток и молодые побеги могут подмерзать в очень холодные и снежные зимы. Если такое произошло, весной вымерзшие части растений нужно обязательно обрезать.

Плохо переносит пузыреплодник застой влаги – его лучше засушить, чем переувлажнить. Парадоксально, но чем меньше внимания вы уделяете растению после посадки, тем лучше для него. Достаточно лишь периодически обрезать и поливать растение и рыхлить землю.

«Ред барон» растет быстро, и если в вашем саду имеются «проблемные» пустые места, пузыреплодник закроет их буквально за 1-2 года. В высоту куст достигает 1,5-2 м, примерно таким будет и диаметр кроны.

Пузыреплодник калинолистный «Ред Барон»


Этот вид имеет гофрированные листья с 4–5 лопастями до 8 см в длину интенсивно темно-красной окраски. У него густая полушаровидная форма кроны. Цветы «Ред Барона» бледновато-розовые, но как правило, усеивают весь куст. Растет это сорт на всех типах почвы, в высоту достигает 1,5-2 м. Абсолютно неприхотливое, очень эффектное и быстрорастущее растение.

Результат дальнейшей селекции пузыреплодников — Ред Барон отличается от Диабло менее интенсивной окраской фактурных листьев, меньшими и компактными размерами. Благодаря этому, может быть использован в тех композициях, где Диабло либо слишком велик, либо агрессивно темный.

Декоративен в течение всего вегетационного периода своей листвой, цветами и плодами. Из-за своих декоративных качеств и, особенно, высокой неприхотливости и стойкости в городских условиях, рекомендован для широкого применения в озеленении города и частных садов. Пузыреплодник Ред Барон способен в течение 2-3 лет закрыть проблемные места, создать яркий элемент в сложных контрастных композициях. Живые изгороди из него очень красивые, плотные и легкие в уходе.

Прекрасно сохраняет свою яркую окраску на солнечных местах. В тенистых – зеленеет, в зависимости от степени освещенности.

Изредка появляющиеся зеленые побеги необходимо вырезать полностью.

Контейнерные растения можно сажать весь сезон. Посадку растений с голым корнем проводят ранней весной, до распускания листьев или осенью, в сентябре. Перед посадкой корни замачивают в воде на 2-5 часов. В посадочную яму глубиной 60см насыпают горкой питательный грунт. Затем помещают туда куст, расправляют корни, засыпают почвой и уплотняют. Обильно проливают почву.
Руководство по уходуПузыреплодник растет на всех типах почв, которые в меру увлажнены и имеют хороший дренаж. Растет как на солнце, так и в полутени. Уход заключается в периодических поливах, подкормках, рыхлении почвы и в обрезке старых побегов. 

Наноразмерная молекулярная морфология пристыкованных экзоцитарных везикул с плотным ядром в нейроэндокринных клетках

Клеточная корреляция белков с везикулами с плотным ядром

Для визуализации экзоцитозных везикул с плотным ядром (DCV) мы сняли крышу с клеток PC12 с небольшой отводящей силой. Эта обработка обнажает поверхность внутренней плазматической мембраны клетки, прикрепленную к покровному стеклу 27 . Цитозоль и несвязанные органеллы вымываются 28 . Остающаяся плазматическая мембрана содержит связанные органеллы, включая филаменты цитоскелета, мембранные белки, эндоцитарные, экзоцитарные везикулы и неизвестные или неопознанные объекты 27 .Когда эти живые мембраны быстро фиксируются, стабилизируются, сушатся и покрываются тонким слоем платины и углерода, высококонтрастное изображение реплики мембраны может быть получено с помощью просвечивающей электронной микроскопии — метода, обычно называемого электронной микроскопией платиновой реплики (PREM ) 29,30 .

Ранее 31,32 , мы использовали световую микроскопию для картирования десятков DCV-связанных белков в живых панкреатических бета-клетках INS-1 и нейроэндокринных клетках PC12 9,11,12,32,33,34 .Мы обнаружили, что Rab-белки и их эффекторы имеют одни из самых высоких значений корреляции с везикулами с плотным ядром 31,32 . Эти изображения, однако, были получены с помощью флуоресцентной микроскопии полного внутреннего отражения с ограничением дифракции (TIRF) и не могли определить суборганелларные положения белков. Таким образом, чтобы картировать эти белки на наноуровне, мы сначала подтвердили ассоциации между Rabs и DCV в некровированных клетках PC12 с помощью микроскопии TIRF. Мы визуализировали две Rab-GTPases (Rab3a и Rab27a) и три эффектора (Rabphilin3a, Rim2 и Granuphilin-a).Мы экспрессировали mCherry или mRFP-меченные Rab или Rab-эффекторные белки вместе со специфическим маркером для DCV — меченным mNeonGreen нейропептидом-Y (NPY-mNG), незащищенными, фиксированными и визуализировали эти мембраны с помощью микроскопии TIRF. Рисунок 1a, b показывает, что эти белки сильно коррелируют с мечеными DCV в некровированных клетках. Эти данные совпадают с измерениями как живых, так и интактных клеток (дополнительный рис. 1b). Таким образом, снятие кровли существенно не меняет значения флуоресцентной корреляции.

Рис. 1: Визуализация ключевых белков DCV на отдельных пузырьках с помощью световой и электронной микроскопии.

a TIRF-микроскопические изображения клеток PC12, котрансфицированных NPY-mNG (первая строка), Rab27a-mCherry (вторая строка) и их наложения (третья строка). В левом столбце показано репрезентативное изображение клетки с масштабной линейкой 3 мкм. В среднем столбце показаны увеличенные изображения из белых квадратов на рисунках в левом столбце. Масштабная линейка 0,5 мкм. Небольшие области из 5 ячеек, нормализованные до самого яркого пикселя и усредненные вместе (правый столбец, масштабная полоса 0,5 мкм). b Корреляционный анализ 8 белков с NPY-mNG-меченными DCV в некровированных клетках PC12.Крайняя левая полоса, помеченная как NPY, представляет собой контроль клеток, котрансфицированных с NPY-mNG и NPY-mCherry. «N» рядом с белками обозначает количество клеток, проанализированных в одном соответствующем эксперименте. Розовые прямоугольники — это диапазон данных 25–75-го процентиля, а усы — стандартное отклонение. Сплошная полоса — это медиана, а мелкая черта — среднее. Знаки × выше и ниже каждого набора данных обозначают 1-й и 99-й процентили. c Изображение TIRF NPY-mNG (голубое), наложенное на изображение PREM (серый цвет) некровированной клеточной мембраны PC12.Это изображение было выбрано из одного из четырех независимых экспериментов, проведенных на иммуномеченных Rab27a клетках PC12. Один кластер DCV и DCV (правая панель) из белых квадратов на левой панели. Сотовый пузырь на верхней панели представляет собой ямку, покрытую клатрином. Масштабные линейки составляют 1 мкм и 100 нм для левой и правой панелей соответственно.

CLEM расположения белков везикул в наномасштабе

Корреляционная световая и электронная микроскопия сверхвысокого разрешения может определять расположение белков в плотном структурном окружении клетки в наномасштабе 17 .Тем не менее, чтобы сопоставить флуоресцентные изображения с известными ЭМ-структурами, объекты, видимые в ЭМ, должны распознаваться по форме, текстуре или положению. Везикулы с плотным ядром на изображениях платиновых реплик выглядят как гладкие круглые объекты, и их трудно однозначно идентифицировать только по изображениям PREM. В частности, в некровированных клетках PC12 DCVs появляются как сферы, которые случайным образом разбросаны по мембране (Supplementary Fig. 3c, выделено синим). Здесь мы могли ошибочно приписать флуоресценцию органелле, которая не является истинным DCV.В качестве контрпримера покрытые клатрином везикулы имеют уникальные сотовые решетки, которые легко идентифицировать (дополнительный рис. 3c, выделен желтым цветом). Чтобы решить эту проблему, мы разработали трехсторонний TIRF, локализацию сверхвысокого разрешения и конвейер корреляционной визуализации на основе PREM для маркировки DCV. Это позволило сопоставить более поздние флуоресцентные изображения сверхвысокого разрешения с подтвержденными структурами DCV в платиновых репликах ЭМ-изображений.

Чтобы маркировать везикулы и идентифицировать DCV, мы использовали тот факт, что DCV загружены NPY и полностью высвобождают этот растворимый груз, когда они запускаются, чтобы подвергнуться экзоцитозу 35 .Таким образом, гладкая круглая везикула, видимая в PREM, которая содержит флуоресценцию NPY-mNG на корреляционном изображении, представляет собой DCV, прикрепленный к плазматической мембране, который еще не слился. Сначала мы получили TIRF-изображения некровированных клеток PC12, экспрессирующих NPY-mNG. Эти ограниченные дифракцией пятна флуоресценции NPY-mNG были затем отнесены к везикулам, помечены и дополнительно изучены (рис. 1c). Затем мы использовали наш ранее разработанный метод корреляции dSTORM и PREM CLEM 17 , чтобы сопоставить расположение сигналов флуоресценции сверхвысокого разрешения относительно этих DCV, проверенных TIRF.Это позволило нам выполнить точную двумерную наноразмерную колокализацию на идентифицированных и проверенных DCV. Представляющие интерес белки были слиты с нефлуоресцентными белками темного GFP (dGFP), экспрессированы и помечены нанотелами GFP, конъюгированными с Alexa Fluor-647. dGFP использовали для белков-мишеней, чтобы зеленый канал оставался доступным для зеленого сигнала меченных mNeonGreen везикул. Клетки также были помечены фаллоидином 568, чтобы подчеркнуть форму клетки. Наконец, представляющие интерес клетки были подготовлены для ЭМ, были сделаны реплики, и изображения этих трех модальностей были коррелированы в цифровом виде, чтобы выровнять наноразмерные локализации белков в клеточном контексте на проверенных везикулах с плотным ядром (дополнительный рис.2г – е).

На рис. 2a – e показаны изображения dSTORM, совмещенные с изображениями PREM для белков, меченных с помощью нанолучки GFP, конъюгированной с Alexa Fluor-647. Изображения CLEM для всех пяти белков (Rab3a, Rab27a, Rabphilin3a, Rim2 и Granuphilin-a) показывают флуоресценцию на везикулах с плотным ядром или близко к ним. Чтобы измерить ассоциацию этих белков с везикулами, мы сгенерировали профили флуоресценции, выделив везикулы, идентифицированные NPY-mNG, и проанализировав средние нормализованные значения пикселей флуоресценции как функцию расстояния от центра или края везикулы.Подробный рабочий процесс анализа показан на дополнительном рис. 2. Для радиальных профилей (рис. 2h) мы объединили пиксели с шагом 12 нм от центра везикулы до 18 интервалов (рис. 2f, g). А для краевых профилей (дополнительный рис. 5) мы разместили ячейки, как описано ранее, для ямок, покрытых клатрином, 16 — 5 ячеек внутрь и 10 ячеек от края везикулы. И радиальный, и краевой профили показывают отличительные пространственные распределения Rab и Rab-эффекторных белков на DCV.

Рис. 2: Корреляционный анализ белков на DCV с помощью dSTORM и платиновой реплики.

Корреляционные изображения клеток PC12, экспрессирующих NPY-mNG и Alexa Fluor-647-GFP-нанотело, меченные темными слитыми белками GFP a Rab3a, b Rab27a, c Rabphilin3a и d Granuphilin-a. e Корреляционное изображение для эндогенного Rim2, меченного антителом против Rim2. Масштабные линейки составляют 500 и 200 нм для левой и правой панелей соответственно. Изображения были вырезаны из более крупных изображений, показанных на дополнительном рисунке 11. Для анализа были созданы ячейки размером десять пикселей, созданные из центра изображения f EM и примененные к соответствующему флуоресцентному изображению со сверхвысоким разрешением g для построения профилей флуоресценции. .Желтый кружок указывает на контур пузырька, а розовые и синие линии — это ячейки внутри и за пределами края пузырька. ч Усредненные и нормализованные профили интенсивности флуоресценции для dGFP-Rab3a ( n = 8 клеток; 458 пузырьков), dGFP-Rab27a ( n = 7 клеток; 545 пузырьков), dGFP-Rabphilin3a ( n = 8 клеток ; 644 везикулы), dGFP-грануфилин-a ( n = 10 клеток; 275 везикул) и anti-Rim2 ( n = 5 клеток; 129 везикул) (дополнительная таблица 1a).Данные о сверхэкспрессии CLEM были собраны из двух (Rab3a, Granuphilin-a) и трех (Rab27a, Rabphilin3a) независимых экспериментов, а данные CLEM с иммунной меткой — из одного эксперимента. Средняя интенсивность флуоресценции показана в виде темной линии (черный = Rab3a; красный = Rab27a; синий = Rabphilin3a; пурпурный = Грануфилин-a), а стандартная ошибка среднего значения показана в прозрачности. Профили интенсивности флуоресценции для эндогенных белков, включая Rab3a, Granuphilin-a и Rim2, представлены на дополнительном рис.5.

Анализ размера везикул показал, что радиусы DCV составляли от 74,7 ± 13,4 до 85,3 ± 16,5 нм для клеток, экспрессируемых грануфилином-а и Rab27a, соответственно (дополнительный рис. 3а). Крутая флуоресценция, наблюдаемая в этом диапазоне, демонстрирует, что эти экзоцитарные белки преимущественно расположены непосредственно на DCV. Профили флуоресценции, полученные для иммуномеченых эндогенных белков (Rab3a, Granuphilin-a и Rim2), демонстрировали такое же распределение флуоресценции, как и временно экспрессируемые гибридные белки.В частности, как радиальный, так и краевой профили показывают, что эндогенные Rab3a, Granuphilin-a и Rim2 локализуются на структурах DCV (Supplementary Fig. 5). Интересно, что эндогенный Rim2 обнаруживает немного другой профиль по сравнению с двумя предыдущими белками и, по-видимому, расположен ближе к краю, а не к центру везикулы.

Физическая морфология DCV была сходной среди клеток, визуализированных для CLEM (74,4 ± 15,1 нм, Anti-Rab3a, 86,4 ± 15,8 нм, Anti-Granuphilin-a, 74,7 ± 13.4 нм, грануфилин-a-GFP, 77,1 ± 16,5 нм, Rab3a-GFP) (дополнительный рис. 3a). Эти образцы имели немного большие DCV по сравнению с нетрансфицированными клетками PC12, наблюдаемыми либо с помощью PREM (60,5 ± 12,1 нм), либо с помощью TEM тонкого среза (63,0 ± 11,4 нм) (дополнительный рис. 3a, c, d). Природа этого увеличения радиуса неясна и может быть результатом экспрессии NPY-mNG или более обширных экспериментальных протоколов, необходимых для CLEM. Плотность меченных NPY-mNG DCV варьировала по всей площади мембраны сверхэкспрессированных клеток (дополнительный рис.3б). Экспрессия GFP-меченых белков может потенциально изменять количество этих белков на пузырьках в популяции, однако предыдущие исследования показали ограниченные эффекты сверхэкспрессии на значения корреляции между белками и DCV в этих клетках 31,32 .

Затем, в качестве теста для нашего анализа, мы оценили влияние обработки изображений dSTORM на наши результаты CLEM. Обычно данные о локализации отображаются путем представления локализаций в виде функций Гаусса, которые становятся выше и тоньше с увеличением фотонов 36 .Гауссовский рендеринг может изменяться в зависимости от различных методов анализа или обнаружения пиков. Данные локализации также могут быть представлены графически путем подсчета количества событий в пикселе в виде гистограммы. Чтобы оценить, как эти два стиля анализа и вывода влияют на наш анализ, мы напрямую сравнили профили белков CLEM, визуализированные тремя разными способами (рендеринг по Гауссу Nikon Elements, рендеринг гистограммы ThunderStorm 37,38 и рендеринг по Гауссу Thunderstorm, подробности в Методах) ( Дополнительный рис.4). В этом сравнительном анализе мы наблюдали, что профили для всех четырех экспрессированных и трех эндогенных белков сохранили свои тенденции независимо от используемого анализа (дополнительный рисунок 5).

Взятые вместе, наши результаты отображают распределение ключевых экзоцитарных белков на DCV в нанометровом масштабе. Все белки, по-видимому, имели одинаковое глобальное распределение без сильной структурной неоднородности в наномасштабе. В частности, мы не смогли обнаружить четкую кольцевую или предвзятую организацию экзоцитарных белков, аналогичную той, которая наблюдается для компонентов ямок, покрытых клатрином 16 .Из этих данных, однако, все еще было неясно, имеют ли экзоцитарные белки слоистые положения относительно плазматической мембраны в вертикальном измерении. Таким образом, мы использовали другой метод для получения подробного трехмерного изображения белков на отдельных DCV.

Картирование белков везикул с помощью нанозолота и EM

Для прямого обнаружения белков в изображениях EM мы трансфицировали клетки белками, помеченными шестью остатками гистидина. Эти гистидиновые белки являются активными мишенями для никель-NTA-золота (Ni-NTA-Au) (рис.3а, б) 18,19,21 . Эта стратегия мечения дает несколько преимуществ: (1) эти короткие гексагистидиновые метки могут быть помечены множеством белков, что позволяет изучать множество различных белков. Обычно это затруднительно при иммуномаркировании из-за отсутствия специфических и надежных антител. (2) В отличие от первичных / вторичных антител, высокоаффинные взаимодействия никель-гистидин помещают наночастицы золота ближе к цели (<5 нм), обеспечивая локализацию с точностью до нанометра 18 .(3) Золотые частицы имеют высокий контраст для электронных лучей по сравнению с клеточным фоном и платиной, что делает их отличными маркерами ЭМ 39 .

Рис. 3: Мечение белка-реплики платины на основе нанозолота на плазматической мембране.

a Схема плазмид, используемых для интересующего белка (POI) с гистидином и GFP, слитыми по N- или C-концевым доменам. b Схема, показывающая связанный с везикулами белок с плотным ядром, меченный Ni-NTA-Au. c His-GFP-Rab27a, mCherry-Rab27a и наложенные изображения, показывающие совместную локализацию с DCV. d Совместная локализация His-GFP-Rab27a и Anti-Histidine-DyLight 488, показывающая доступность гистидинового эпитопа. Проверочные эксперименты проводились один раз. Шкала 3 мкм. Увеличенный небольшой участок (белое поле) для каждого изображения находится в правом верхнем углу. Масштабная линейка 0,5 мкм. Платиновые реплики изображений клеток HeLa (урожай из увеличенного изображения PREM клетки на дополнительном рисунке 12), экспрессированных с e His-GFP-Clathrin Light Chain A, f His-Cavin-GFP и g EPS15- GFP-His.Масштаб на левой панели составляет 200 нм. Увеличенные изображения на средней панели показывают частицы золота на эндоцитарных структурах, отмеченные оранжевыми кружками. На таких же увеличенных изображениях на правой панели показаны структуры без оранжевой маркировки. Масштабная шкала 150 нм. Раздел томограммы (вид XY, , масштабная линейка = 100 нм) отдельной структуры клатрина, помеченной Ni-NTA-Au, для ч легкой цепи клатрина A, i cavin1 и j EPS15, а также ортогональные виды в размерах XZ (масштабная линейка = 100 нм) и YZ (масштабная линейка = 50 нм).Голубыми пунктирными линиями отмечены частицы золота, видимые на виде XY среза z , и обозначено их расположение на ортогональных видах. Два независимых эксперимента по визуализации были выполнены для 2D- и 3D-EM.

Чтобы протестировать эту систему, мы сначала оценили экспрессию, локализацию и мечение белков, меченных гистами, на DCV. На рисунке 3c показана совместная локализация His-меченного GFP-Rab27a с mCherry-Rab27a. Аналогичным образом, His-GFP-Rab27a и антигистидин DyLight 488 сильно колокализуются (рис.3d). Это подтверждает, что его гибридные белки нацелены на DCV и доступны для связанных никелем NTA-зондов. Затем мы выбрали два хорошо известных белка оболочки эндоцитов для оценки метода в EM — легкая цепь клатрина A и cavin1. В обоих случаях гекса-гистидиновые метки были добавлены либо к N-, либо к C-концу конструкции слияния с GFP-меткой (рис. 3а, схема). Легкая цепь А клатрина является частью полиэдрической оболочки, которая управляет клатрин-опосредованным эндоцитозом 40,41 . Cavin1 принадлежит к семейству белков Cavin и является компонентом архитектурной оболочки кавеол 42 .Для визуализации мы выбрали клетки с флуоресценцией GFP — маркером экспрессии белков, меченных гексагистидином. Затем мы подготовили эти образцы для PREM и визуализировали их в ЭМ. Подробный конвейер визуализации показан на дополнительном рис. 6. Как известно, эндоцитарные белки, используемые здесь в качестве контроля, покрывают везикулы. Таким образом, мы ожидали, что везикулы будут заключены в кластеры золотых частиц. При ЭМ наблюдались клатриновые и кавеолы, украшенные частицами золота (рис. 3д, е). Это наблюдение было воспроизведено для клатрина в клетках глиобластомы U87-MG (дополнительный рис.12). На рис. 3e – g показаны частицы золота, выделенные желтыми точками на центральной панели. Электронные томограммы дополнительно подтвердили, что частицы золота были распределены по всей высоте пузырьков (рис. 3h, i и дополнительные видеоролики 1, 2). Следует отметить, что мы наблюдали минимальное неспецифическое мечение в других органеллах, областях плазматической мембраны или клетках без флуоресценции GFP.

Чтобы дополнительно проверить надежность этого метода, мы визуализировали EPS15, белок, о котором известно, что он локализован на краю или основании зарождающихся структур, покрытых клатрином 43 .В клетках, экспрессирующих EPS15-His, меченных Ni-NTA-Au, мы обнаружили частицы золота на краю и внизу клатрина (рис. 3g, j и дополнительный ролик 3). В качестве финального теста мы визуализировали второй локализованный по краю белок FCHO2 16,44 . Опять же, мы наблюдали аналогичное распределение частиц золота на краях покрытых клатрином структур (дополнительный рис. 12). Специфическое нацеливание двух известных краевых белков на обод везикул, покрытых клатрином, поддерживает наш метод наноразмерной локализации белка в 3D.

Трехмерное распределение белков на везикулах

Затем мы исследовали неизвестное трехмерное положение в наномасштабе пяти Rab-GTPаз и их эффекторных белков на DCV клеток PC12. Эти белки были помечены шестью остатками гистидина на N-концах, и после трансфекции мембранные листы были помечены Ni-NTA-Au. Подобно двум белкам эндоцитарной оболочки, мы обнаружили как Rab27a, Rab3a, так и их эффекторные белки Rabphilin3a, Granuphilin-a и Rim2, нацеленные на везикулы. Частицы золота были разбросаны по всей поверхности везикулы (рис.4а – д). В 3D электронные томограммы показывают, что частицы золота были распределены по всей высоте DCVs, аналогично положениям, наблюдаемым для контрольных белков оболочки эндоцитов (Fig. 4f-j и Supplementary Movies 4-8). Для клатрина, cavin1, Rab и Rab-эффекторных белков мы наблюдали ряд частиц золота, связанных с отдельными везикулами, от 2 до 42 частиц. Для EPS15 — в соответствии с ранее наблюдаемым разреженным распределением по краю везикул, покрытых клатрином, и пониженной концентрацией в куполообразных пузырьках 16 — мы обнаружили отдельные структуры, помеченные низкой плотностью золота (от 1 до 7 частиц).

Рис. 4: Мечение золотым нанозондом белков DCV, визуализированных с помощью 2D и 3D PREM.

2D PREM-изображения клеток PC12, трансфицированных His-tag a Rab3a, b Rab27a, c Rabphilin3a, d Granuphilin-a и e Rim2. Верхняя панель показывает репрезентативную культуру из большего изображения клетки PREM (дополнительный рис. 12), а нижняя панель показывает увеличенные примеры отдельных структур DCV, помеченных Ni-NTA-Au. Масштабные линейки составляют 200 и 100 нм соответственно.Срез томограммы (вид XY, , масштабная линейка = 100 нм) отдельной структуры DCV, помеченной Ni-NTA-Au для f Rab3a, g Rab27a, h Rabphilin3a, i Granuphilin-a и j Rim2 и XZ (масштабная шкала = 100 нм) и YZ (масштабная шкала = 50 нм) виды для среза z , обозначенных голубыми пунктирными линиями. Два независимых эксперимента по визуализации были выполнены для 2D- и 3D-EM.

После трехмерной реконструкции электронных томограмм для каждого белка мы проанализировали кумулятивное радиальное и осевое положение частиц золота по отношению к мембране везикул.Отрезки томограмм обведены замкнутым контуром (пурпурным цветом). Это представляет собой набор координатных точек, обозначающих мембрану везикул. Точно так же мы использовали точки (синие) в качестве объектов, чтобы пометить независимые частицы золота, обнаруженные около этих сегментов мембран (рис. 5a, b). Координаты радиуса и высоты из контуров мембраны и 4636 золотых точек были собраны из 623 пузырьков (дополнительная таблица 2). Положение каждой точки определялось двумя значениями: (1) радиальным расстоянием от центра тяжести поперечного сечения и (2) высотой точки от плазматической мембраны.Чтобы проанализировать распределение белков, мы создали средний профиль мембраны везикул и оценили радиальное и аксиальное положения относительно мембран. Для каждого поперечного сечения везикулы мы сначала собрали радиальное расстояние от центра тяжести поперечного сечения для каждой точки контура. Мы нормализовали радиусы с точкой с максимальным радиусом в каждом поперечном сечении и высотой с максимальной высотой этого пузырька. Затем для каждой частицы мы нормализовали высоту с максимальной высотой пузырька.Чтобы нормировать радиус частицы в данном поперечном сечении, мы вывели луч из центроида, проходящий через золотую частицу и достигающий контура. Радиус контура в этом положении использовался для нормализации относительного положения частицы. Мы объединили нормализованные высоты и радиусы контуров из диапазона 54–65 везикул (для легкой цепи клатрина A и EPS15, соответственно) и связанных 193–700 частиц золота (для EPS15 и легкой цепи клатрина A, соответственно). собраны из двух независимых экспериментов для каждого белка (дополнительный рис.7 и дополнительная таблица 2). Данные были расположены в порядке возрастания высоты. Затем были получены средние значения разделов путем деления высот на 10 интервалов. Наконец, средние профили распределения были получены путем построения графика зависимости нормализованной высоты бункера от нормализованного радиального расстояния (рис. 5b).

Рис. 5: 3D-картирование белков на везикулах с нанозолотом.

a Томограмма z срезов единственной везикулы, покрытой клатрином, от пика до основания структуры. b Трехмерная модель везикулы по точкам контура мембраны (пурпурный) и точек рассеяния для частиц золота (синий) (верхняя панель, масштабная линейка = 50 нм).Схема (нижняя панель) для получения положений золотых частиц относительно контуров мембраны везикул. Радиус каждой точки контура (пурпурный, r ), ее высота от основания пузырька ( Z ), радиус золотой частицы (синий) и ее высота. Репрезентативный профиль справа, показывающий распределение частиц золота (синий) по отношению к мембране везикул (красный). c Пространственно усредненный и нормализованный профиль распределения клатрина, cavin1, EPS15, Rab3a, Rab27a, Rabphilin3a, Granuphilin-a и Rim2 на везикулах.Частицы отражаются по оси ординат. d Плотность меченных золотом белков по высоте везикулы (10 ячеек). Гистограммы показывают сумму частиц в каждой ячейке (для всех везикул), деленную на средний радиус ячейки на везикулу. Общее количество везикул, собранных и проанализированных в двух независимых экспериментах (для a d ), составляет: легкая цепь клатрина A, 54; Cavin1, 63; EPS15, 65; Rab3a, 59; Rab27a, 58; Rabphilin3a, 58; Грануфилин-а, 62; Rim2, 63 (дополнительная таблица 2).

На рис. 5c мы показываем профили распределения золотых частиц по отношению к везикулярной мембране для трех контрольных эндоцитарных и пяти экзоцитарных белков Rab. Здесь мы отразили те же точки по оси ординат, чтобы обеспечить визуальный вид сферического пузырька для визуализации и интерпретации. Графики легкой цепи А клатрина и cavin1 показывают универсальное распределение золота. Это открытие согласуется с тем фактом, что белки легкой цепи А клатрина и белки cavin1 покрывают эти везикулы.Кроме того, среднее распределение золота для EPS15 поддерживает белок, локализованный по краю, в клатриновых сайтах. Однако, подобно двум белкам эндоцитарной оболочки, пять белков Rab, ассоциированных с DCV, и их партнеры по связыванию обнаруживают глобальное распределение. Кроме того, мы вычислили частоту обнаружения золотых частиц в 10 отдельных вертикальных ячейках, чтобы оценить однородность распределения белка по высоте везикул. На рисунке 5d представлены гистограммы плотности нормализованной частоты золотых частиц в усредненном распределении поперечного сечения на везикулу по высоте везикулы для восьми отдельных белков.Мы обнаружили сильную разницу в распределении между двумя белками эндоцитарной оболочки и пятью экзоцитарными белками Rab по сравнению с EPS15. Все первые семь белков обладают одинаковой плотностью белка относительно EPS15. Однако судить о незначительных изменениях плотности сложно. Отметим, что есть различия в гистограммах плотности золота по направлению к вершине везикулы. Значимость этих различий не может быть подтверждена, потому что в этом анализе возникает большая ошибка в дифференциальной площади поперечного сечения самой вершины везикул.Чтобы быть осторожным, эти небольшие различия не отражены в нашей модели консенсуса. Одномерный (1D) вид позиций золота вдоль спроецированного профиля мембраны был получен путем нанесения их нормализованного радиального расстояния от центра тяжести поперечного сечения. Опять же, это упрощенное представление показывает, как глобальное распределение белков оболочки и Rab белков отличается от распределенного по краям местоположения EPS15 (Supplementary Fig. 9a, b). Эти закономерности распределения также можно увидеть на графиках отдельных везикул (дополнительный рис.9c – f).

Затем мы изучили два белка плазматической мембраны, Syntaxin1A и SNAP25. Оба являются заякоренными в мембране t-SNAREs, необходимыми для слияния пузырьков 2,8 . Было показано, что они группируются в пристыкованных DCV 45,46 . Как ранее наблюдалось, 32,47 , Syntaxin1A и, в меньшей степени, SNAP25, совместно локализуются с DCVs (Fig. 1b and Supplementary Fig. 1a). Чтобы отобразить эти белки в наномасштабе, мы создали гист-гибридные конструкции Syntaxin1A и SNAP25, трансфицировали клетки PC12 и визуализировали их после обработки Ni-NTA-Au.Как и ожидалось, мы наблюдали частицы золота около везикул в клетках, экспрессирующих Syntaxin1A и SNAP25. Томограммы показали, что частицы преимущественно располагались в основании и плазматической мембране вблизи DCV (рис. 6a, d и дополнительные видеоролики 9, 10). Распределение золотых частиц относительно мембраны везикул показывает, что как Syntaxin1A, так и SNAP25 группируются около основания DCVs и мембраны (Рис. 6b, e). Для Syntaxin1A гистограмма плотности показывает устойчивое уменьшение содержания золота от основания к вершине везикулы (рис.6в). Сходным образом для SNAP25 частицы золота в значительной степени сконцентрированы на плазматической мембране (рис. 6f). Следует отметить, что SNAP25 более плотный и более диффузный в плазматической мембране на флуоресцентных изображениях TIRF 31,46,47 . В соответствии с этим наблюдением, мы наблюдаем больше мечения SNAP25-Ni-NTA-Au на мембране (рис. 6d и дополнительный рис. 12).

PREM, где образцы закреплены и покрыты металлом под острым углом, не позволяет четко визуализировать узкие пространства ниже DCV, которые иногда можно увидеть с круглыми пузырьками при замораживании тонких срезов под высоким давлением 48 .Таким образом, сложно оценить структуру небольшого пространства непосредственно под DCV. Тем не менее, распределение белков t-SNARE под и вокруг DCV подтверждает наши наблюдения глобального и некластеризованного распределения Rab и эффекторов. Однако необходимы дальнейшие исследования, чтобы точно локализовать белки в узкой зоне контакта под везикулами как можно ближе к живым образцам. Быстрое замораживание и криоэлектронная томография хорошо подходят для получения этих данных.

Рис. 6: 2D и 3D визуализация Syntaxin1A и SNAP25 на DCV.

2D PREM-изображения клеток PC12, трансфицированных His-tag a Syntaxin1A и d SNAP25. Левая панель (масштабная полоса 200 нм) показывает репрезентативную культуру из большего изображения PREM (дополнительный рисунок 12), средняя панель (масштабная полоса = 100 нм) показывает увеличенные примеры отдельных структур DCV, помеченных Ni-NTA-Au. , а правая панель показывает срез томограммы (вид XY, , масштабная полоса = 100 нм) отдельной структуры DCV, помеченной Ni-NTA-Au и XZ (масштабная полоса = 100 нм) и YZ (шкала bar = 50 нм) видов для среза z , обозначенных голубыми пунктирными линиями. b , e Пространственно усредненные и нормализованные профили распределения для Syntaxin1A и SNAP25. Частицы золота отражаются по оси ординат. c , f Плотность меченных золотом белков по высоте везикулы (10 ячеек). Гистограммы показывают сумму частиц в каждой ячейке (для всех везикул), деленную на средний радиус ячейки на везикулу. Общее количество везикул, собранных и проанализированных в двух независимых экспериментах (для a f ), составляет Syntaxin1A: 76 и SNAP25: 65 (дополнительная таблица 2).

Распределение эндогенных белков на везикулах

В качестве другого контроля мы сравнили результаты с трехмерной флуоресцентной микроскопией сверхвысокого разрешения (3D-STORM), визуализирующей эндогенные белки. Для этого мы исследовали белки, для которых коммерчески доступны хорошо задокументированные антитела, включая тяжелую цепь клатрина, EPS15, Rab3a и грануфилин-а. Мы вскрыли клетки, иммуномеченные антителами, и получили изображения 3D-STORM в соответствии с ранее опубликованным методом 49 .Тяжелая цепь клатрина является компонентом трискелии клатрина, которая вместе с легкой цепью клатрина образует многогранные сотовые клатриновые оболочки 40 . Следовательно, ожидается, что тяжелая цепь клатрина будет локализована с тем же профилем, что и легкая цепь клатрина. 3D-STORM позволяет получать изображения с осевым разрешением 50 нм, и, таким образом, он способен различать везикулы размером 100–200 нм в 3D 49 . Изображения, полученные от иммуномеченных тяжелых цепей клатрина клеток, показали куполообразные структуры клатрина размером 100–200 нм (дополнительный рис.8). Для EPS15 мы не наблюдали куполов, подтверждая положение края / дна этого белка на пузырьках (дополнительный рис. 8). Для Rab3a и Granuphilin-a мы наблюдали фокусы DCV длиной 100–150 нм, отходящие от клеточной мембраны, поддерживая глобальное распределение этих белков (Supplementary Fig. 8). В качестве другого контроля мы провели мечение эндогенных белков иммунным золотом. Во-первых, мы пометили тяжелую цепь клатрина и EPS15 в некровированных клетках HeLa. Образцы PREM были приготовлены в соответствии с нашими стандартными протоколами. Мы наблюдали редко меченую тяжелую цепь клатрина, окружающую везикулы, покрытые клатрином, и EPS15 на краю клатриновых сайтов (дополнительный рис.10а, б). Эти распределения совпадали с теми, которые мы наблюдали с меткой золотого метки his-tag. Однако с помощью PREM иммуноголд не смог обнаружить эндогенный Rab3a и грануфилин-a. Поддерживая данные о метке золотом, при таком разрешении одной только трехмерной локализационной микроскопии недостаточно для обнаружения белков с достаточной точностью для разработки точной структурной модели в наномасштабе. Кроме того, иммунное золото было подтверждающим, но его нельзя было широко применить ко всем интересующим белкам. Таким образом, потенциал этих новых методов для визуализации неисследованных белков, представляющих интерес, в изотропных масштабах, приближающихся к 1 нм в 3D, заслуживает внимания.

Сфингомиелин сортируется в транс-сети Гольджи в отдельный класс секреторных пузырьков

Обширные доказательства указывают на то, что белки в транс-сети Гольджи (TGN) сортируются на отдельные типы транспортных носителей, производных от Гольджи (1), но мало что известно о содержании липидов в различных носителях. Самый распространенный сфинголипид, сфингомиелин (SM), является основным компонентом плазматической мембраны, который синтезируется на листках просветной мембраны мембран TGN и транспортируется к плазматической мембране неописанным путем.Сообщалось, что ингибирование синтеза SM замедляет перенос из Гольджи в плазматическую мембрану белка G вируса везикулярного стоматита, гемагглютинина гриппа и фактора, активируемого аденокарциномой поджелудочной железы (2⇓⇓⇓-6), что позволяет предположить, что путь биосинтеза SM широко распространен. требуется для секреторной компетентности, но лежащие в основе механизмы неизвестны. Более того, остается неясным, задействован ли трафик SM как таковой или активность метаболитов SM, таких как церамид и диацилглицерин (DAG), для производства секреторных пузырьков.

Во многих исследованиях внутриклеточной сортировки сфинголипидов используются синтетические короткоцепочечные церамиды, меченные флуоресцентной составляющей, которая может метаболизироваться, хотя и с медленными нефизиологическими скоростями, в короткоцепочечные флуоресцентные SM и глюкозилцерамид (7-9). В одном из первых исследований сортировки SM в линии поляризованных эпителиальных клеток, инкубированных с флуоресцентным короткоцепочечным церамидом, флуоресцентно меченые липиды накапливались до более высокого уровня в апикальном мембранном домене по сравнению с базолатеральным доменом, что позволяет предположить, что флуоресцентно меченые сфинголипиды обогащены в апикально нацеленных секреторных пузырьках (9).Исследование липидного состава секреторных везикул дрожжевых клеток ( Saccharomyces cerevisiae ), которые продуцируют маннозилированные сфинголипиды (но не SM) и эргостерин (но не холестерин), показало, что два типа иммуноочищенных секреторных везикул не различаются по содержанию различные виды липидов (10, 11). Т.о., степень, в которой происходит сортировка липидов в TGN, остается плохо решенной, частично из-за экспериментальных проблем с мониторингом содержания липидов в индивидуальных секреторных пузырьках.В настоящем исследовании мы разработали экспериментальный подход для визуализации SM в живых клетках с использованием сконструированного белка, который связывает нативный SM, и реализовали его для решения вопроса о том, равномерно ли SM распределены среди различных типов секреторных пузырьков.

Результаты и обсуждение

Генетически закодированный зонд для определения сфингомиелина.

Распределение SM на плазматической мембране было исследовано с помощью множества флуоресцентно меченных порообразующих токсинов, происходящих из морских организмов, которые связываются непосредственно с SM (12, 13), и мы попытались создать биосенсор SM, используя один из них. , эквинатоксин II (Eqt), как каркас.Eqt является членом семейства актинопоринов, группы небольших (~ 20 кДа), исключительно стабильных белков, которые секретируются в виде неактивных мономеров и претерпевают конформационные изменения, чтобы олигомеризоваться в цитотоксическую пору в мембранах, содержащих SM (14⇓⇓⇓⇓⇓– 20) (рис.1 A ). Структура поры, образованная гомологичным фрагацеатоксином С актинопорина (FraC), связанным с липидами (16), предполагает, что пора имеет два сайта связывания SM на протомер. Учитывая площадь поверхности поры, эта стехиометрия указывает на то, что актинопорины не могут концентрировать SM выше физиологической концентрации SM в мембранах Гольджи (21, 22).Тем не менее, два свойства нативного Eqt ставят под угрозу его использование в качестве биосенсора SM в живых клетках: Eqt является цитотоксичным, и, хотя он специфически и с высоким сродством связывается с SM, он также активно связывается с мембранами, не содержащими SM (23) (рис. 1 В ).

Рис. 1.

Мембрансвязывающие свойства и локализация производных Eqt. ( A ) Местоположение мутаций, представленных в формуле. Представлена ​​структура протомера актинопорина (FraC) в его олигомерной порообразующей конформации (28) с указанными мутациями, которые мы ввели.Остаток на N-концевой спирали, V22, который был заменен на триптофан для устранения порообразования, показан фиолетовым цветом. Y108, который был заменен на изолейцин в Eqt-SM, отмечен оранжевым цветом, а Y113, который был заменен на изолейцин в Eqt-sol, — красным. ( B ) Анализы связывания везикул. Указанные белки Eqt инкубировали с везикулами, содержащими 20% SM или фосфатидилхолина (и 20% холестерина), и везикулы собирали центрифугированием. Связанные фракции осадка (P) и несвязанного супернатанта (S) визуализировали окрашиванием кумасси синим и количественно определяли.Показаны средние значения трех независимых экспериментов. Стандарты молекулярной массы (кДа) указаны слева. Мутанты Y108 и Y113 также включают мутацию V22W. ( C ) Eqt-V22W, Y108I распознает SM в плазматической мембране интактных клеток. Рекомбинантный Eqt-Y108I или Eqt-Y113I, меченный эпитопом FLAG, инкубировали с клетками HeLa, которые были инкубированы с SMase или обработаны ложно. Затем клетки промывали, фиксировали и инкубировали с анти-FLAG и мечеными вторичными антителами. ( D ) Локализация Eqt-SM и Eqt-sol в клетках HeLa.Плазмиды, кодирующие указанные белки, трансфицировали в клетки HeLa и визуализировали деконволюционной флуоресцентной микроскопией через 16 ч после трансфекции. Стрелки указывают на примеры цитоплазматических точек, содержащих Eqt-SM. Показаны максимальные проекции серии z. (Масштаб: 10 мкм.)

Мы стремились ввести мутации в нативную зрелую последовательность Eqt (кодоны 199-735), которые снижают его порообразующую активность и, следовательно, токсичность, а также его независимость от SM мембран. связывающая активность.Было показано, что мутация V22W стабилизирует Eqt в связанном с мембраной состоянии до образования пор, практически устраняя его цитолитическую активность (15). В кристаллической структуре поры FraC (16) боковая цепь Val22 выступает в гидрофобную область мембранного бислоя, что согласуется с предположением, что эта мутация ингибирует трансбислойную вставку порообразующей спирали (15). Используя анализ коседиментации липосом, мы обнаружили, что рекомбинантный Eqt (V22W) сохраняет распознавание SM, и поэтому мы сохранили эту мутацию во всех последующих модификациях.

Предполагается, что гидрофобная поверхность, богатая ароматическими остатками, обеспечивает начальное связывание с мембраной независимо от распознавания SM (17⇓⇓ – 20, 23, 24). Соответственно, мы нацелены на гидрофобные остатки в этой области для консервативных замен боковых цепей и проанализировали липид-связывающую специфичность рекомбинантных мутантных форм Eqt путем седиментации липосом (фиг. 1 A ). Эта стратегия в конечном итоге привела нас к выявлению консервативной мутации Y108I (Eqt-V22W, Y108I), которая приводит к белку, который активно связывается с везикулами, содержащими 20 молярных процентов SM (и 60 мольных процентов фосфатидилхолина и 20 мольных процентов холестерина), но не связываются активно с везикулами, в которых фосфатидилхолин замещен SM (рис.1 В ). Напротив, мутация Y113I (Eqt-V22W, Y113I) отменяет всю мембранно-связывающую активность (рис. 1 B ) (23). Этот мутантный белок может служить контролем для связывания с мембраной в будущих экспериментах. Мы отмечаем, что характеристики экспрессии, растворимости и очистки каждого мутантного белка были неотличимы от таковых для Eqt дикого типа, предполагая, что эти мутации не нарушают структурную целостность белков.

Мы дополнительно исследовали мембранно-связывающие свойства очищенных, помеченных эпитопом FLAG Eqt (V22W, Y108I) и Eqt (V22W, Y113I) в более физиологическом контексте, исследуя их связывание с плазматическими мембранами живых культивированных клеток, которые были обработанные сфингомиелиназой (SMase) (рис.1 С ). Результаты показывают, что Eqt (V22W, Y108I) связывается с плазматическими мембранами контрольных клеток, но не с мембранами клеток, обработанных SMase, и что Eqt (V22W, Y113I) не связывается с плазматическими мембранами необработанных или обработанных клеток.

Эффекты мутаций Y108I и Y113I теперь могут быть объяснены с помощью кристаллических структур FraC (16), а также молекулярного моделирования Eqt, связанного с мицеллами SM и фосфатидилхолина (25), опубликованного после того, как наши инженерные усилия были завершены.SM, вероятно, отличается от фосфатидилхолина по двум сайтам связывания. Один из этих сайтов находится на границе раздела между каждым из восьми протомеров FraC, где связанные молекулы SM образуют часть поры (16). Второй сайт (обозначенный «L2» в ссылке 16) находится в гидрофобном участке, который мы мутагенизировали. Мутация Y113I, вероятно, отменяет распознавание SM в этом сайте, а также затрагивает соседний «неспецифический» (т.е. сайт, который не различает SM) липид-связывающий сайт (названный «L3» в ссылке 16).Мутация Y108I должна косвенно воздействовать на неспецифический сайт связывания L3, но не влиять на распознавание SM в сайте L2 (16, 23, 25).

Eqt-SM экспортирован из Гольджи.

SM ограничивается экзофациальными листочками клеточных мембран. Таким образом, для визуализации белков Eqt в секреторном пути мы заменили его нативные сигнальные и про-последовательности на сигнальную последовательность гормона роста человека и слили с его С-концом ген, кодирующий oxGFP (26). В дальнейшем помеченная форма сигнальной последовательности-Eqt (V22W, Y108I) упоминается как «Eqt-SM», чтобы указать ее специфичность для SM, а сигнальная последовательность-Eqt (V22W, Y113I) упоминается как «Eqt-sol. ”, Чтобы указать, что это растворимая версия уравнения.

Плазмиды, содержащие слитые гены, котрансфицировали в клетки HeLa с помощью плазмиды, которая направляет экспрессию флуоресцентно меченой формы β1, 4-галактозилтрансферазы (GalT-mKate2), резидента TGN (фиг. 1 D ). Иммуноблоттинг против GFP показал эквивалентные уровни Eqt-SM и Eqt-sol при экспрессии таким образом. При окрашивании трансфицированных культур витальным красителем (трипановый синий) окрашивали 16% клеток Eqt-V22W, 7% клеток Eqt-SM, 3% клеток Eqt-sol и 2% ложно трансфицированных клеток.Напротив, трансфекция клеток вектором для экспрессии нативного Eqt (в виде слияния генов, аналогичных Eqt-SM) вызвала такую ​​обширную гибель клеток, что невозможно было точно определить окрашивание витальным красителем; несколько клеток, которые пережили трансфекцию, содержали многочисленные большие вакуоли, а компартмент GalT был сильно фрагментирован (фиг. S1 A ). Эти результаты подтверждают, что комбинация мутаций V22 и Y108 в значительной степени снижает токсичность Eqt-SM и что его экспрессия не вызывает каких-либо серьезных изменений морфологии Гольджи.

Рис. S1.

Локализация Eqt WT и V22W и трипановый синий гасит флуоресценцию Eqt-SM-pHlourin. ( A ) Локализация Eqt-V22W и нативного Eqt в клетках HeLa. Плазмиды, кодирующие указанные белки, трансфицировали в клетки HeLa и визуализировали деконволюционной флуоресцентной микроскопией через 16 ч после трансфекции. Показаны максимальные проекции z-ряда. (Масштаб: 10 мкм.) ( B , Left ) Клетки, экспрессирующие Eqt-SM-pHlourin перед добавлением трипанового синего в культуральную среду.( B , Right ) Те же клетки сфотографировали через ~ 30 с после добавления трипанового синего (концентрация) в культуральную среду. Показаны максимальные проекции z-ряда. (Масштаб: 10 мкм.)

Затем мы попытались определить, сообщает ли Eqt-SM динамику SM в секреторном пути, сравнивая распределение и секрецию Eqt-SM и Eqt-sol. Внутри клетки Eqt-SM заметно локализуется в отсеках, украшенных GalT-mKate2 (корреляция Пирсона, R ср = 0.77) и пунктам (138 ± 47 точек / клетка), которые не содержат GalT-mKate2 и распределены по цитоплазме (фиг. 1 D , стрелки). Хотя и Eqt-SM, и Eqt-sol заметно локализовались в аппарате Гольджи, было меньше цитоплазматических точек, содержащих Eqt-sol (18 ± 10 точек на клетку), по сравнению с Eqt-SM (рис. 1 D и таблица S1). Исследования колокализации на основе флуоресценции (рис. S2) показали, что большинство точек Eqt-SM не являются органеллами эндолизосомальной системы.

Таблица S1.

Количественное определение внутриклеточных везикул, содержащих Eqt-SM

Рис. S2.

Eqt-SM не локализуется в органеллах эндолизосомальной системы. ( A ) Плазмиды, кодирующие указанные белки, трансфицировали в клетки HeLa и визуализировали с помощью флуоресцентной микроскопии деконволюции через 16 часов после трансфекции. Показаны максимальные проекции z-ряда. (Масштаб: 10 мкм.) ( B ) Средние коэффициенты корреляции Пирсона ( R , , среднее значение ) для Eqt-SM и различных эндолизосомных маркеров были рассчитаны как минимум для 30 клеток в трех экспериментах.Чтобы обеспечить ориентиры для интерпретации этих значений, мы включили положительный контроль для колокализации, Lamp2-GFP и Lamp2-mKate2, и отрицательный контроль для колокализации (NPY-GFP, растворимый секретируемый белок) и LysoTracker (Thermo Fisher Scientific).

Чтобы проверить, получены ли точки Eqt-SM из аппарата Гольджи, клетки инкубировали при 20 ° C в течение 3 часов, чтобы заблокировать экспорт из TGN (27), и определяли внешний вид Eqt-SM. Эта инкубация привела к> 10-кратному истощению Eqt-SM-содержащих цитоплазматических точек (12 ± 7 точек на клетку) и накоплению Eqt-SM в Golgi (рис.2 A и Таблица S1). Важно отметить, что высвобождение блока при 20 ° C путем инкубации клеток при 37 ° C в течение всего 30 минут привело к повторному появлению Eqt-SM в цитоплазматических точках (42 ± 22 точки на клетку), демонстрируя, что точки Eqt-SM связаны с активным экспортом Гольджи (рис. 2 A ). Эти результаты показывают, что Eqt-SM упакован в везикулы, происходящие из TGN.

Рис. 2.

Везикулы, содержащие инженерный Eqt, сливаются с плазматической мембраной. ( A ) Блокировка экспорта из Гольджи приводит к сохранению Eqt-SM.Клетки HeLa, экспрессирующие Eqt-SM (помеченные oxGFP), инкубировали при 20 ° C в течение 2 ч (верхний ряд) для остановки экспорта из TGN, а затем переносили при 37 ° C на 30 мин. Стрелки указывают на цитоплазматические точки, содержащие Eqt-SM, которые появились после высвобождения блока экспорта Гольджи при 20 ° C. Показаны максимальные проекции z-ряда. (Масштаб: 10 мкм.) ( B ) Типичные рамки TIRFM для Eqt-SM и Eqt-sol. ( C ) TIRFM, показывающий везикулы, содержащие Eqt-SM и Eqt-sol, слитые с плазматической мембраной.Зеленые и красные кривые показывают средние нормированные интенсивности флуоресценции для Eqt-SM ( n = 413) и Eqt-sol ( n = 268) событий слияния везикул, соответственно (интенсивность до слияния определяется как 0; интенсивность после слияния определяется как 1 ). Показаны SD для каждой точки. ( D ) Скорости экзоцитозных событий Eqt-SM и Eqt-sol, определенные с помощью визуализации TIRFM и выраженные как количество событий слияния на площадь ( 2 мкм) за время (мин). Показаны SEM. Показатели статистически не различаются ( P ≤ 0.06).

Покадровая визуализация пузырьков Eqt-SM (фильм S1) показывает, что они перемещаются от аппарата Гольджи к поверхности клетки. Мы предположили, что цитоплазматические точки Eqt-SM являются секреторными пузырьками, и получили подтверждающие доказательства этого из визуализации Eqt-SM с помощью флуоресцентной микроскопии полного внутреннего отражения (TIRFM) (рис. 2 B и Movie S2). В этих экспериментах oxGFP был заменен pH-чувствительным флуоресцентным белком pHlourin (28), который позволяет окончательно детектировать экзоцитозные события по вспышке флуоресценции, возникающей при воздействии pHlourin на более высокий pH культуральной среды.Наблюдение за 413 экзоцитарными событиями подтвердило, что Eqt-SM и Eqt-sol секретируются из клетки (фиг. 2 B и C ). Мы также подтвердили, что Eqt-SM-pHlourin связан с клеточной поверхностью, продемонстрировав, что сигнал флуоресценции может быть погашен добавлением трипанового синего (29) в культуральную среду (рис. S1 B ). Количественное определение средней скорости экзоцитоза везикул, содержащих Eqt-SM- и Eqt-sol, показало, что везикулы Eqt-sol сливаются с большей скоростью, чем везикулы Eqt-SM (1.3 × 10 −3 против 9,1 × 10 −4 событий / мин соответственно; P ≤ 0,06). Хотя это различие имеет лишь умеренную статистическую значимость, оно объясняет, по крайней мере частично, почему в устойчивом состоянии наблюдалось меньшее количество цитоплазматических везикул Eqt-sol, чем везикул Eqt-SM (Рис. 1). Профили затухания постфузионной флуоресценции для Eqt-SM и Eqt-sol перекрываются для начальной фазы (~ 0,5 секунды), но затем расходятся; сигнал от Eqt-sol падает до базового уровня в течение 2 с из-за его диффузии от мембраны, тогда как сигнал Eqt-SM сохраняется благодаря его ассоциации с мембраной.Любопытно, что после экзоцитоза сигнал Eqt-SM обычно остается рядом с местом экзоцитоза (Movie S2). Это может указывать на то, что места доставки и диффузии Eqt-SM ограничены на / внутри плазматической мембраны; однако в этом исследовании мы сосредоточили дальнейший анализ на событиях до слияния.

Синтез SM способствует экспорту Eqt-SM из Гольджи.

Основным местом синтеза SM является аппарат Гольджи (30–32), и было обнаружено, что ингибирование синтеза SM снижает скорость секреции некоторых белков (2–6).Чтобы изучить влияние возмущений на синтез SM на транспорт Eqt-SM, мы использовали два разных метода для ингибирования синтеза SM, а затем определили последствия для локализации и секреции Eqt-SM. Во-первых, РНК-интерференция использовалась для истощения клеток основных SM-синтаз (SMS), SMS1 и SMS2. Количество мРНК SMS1 и SMS2 в наших культурах через 2 дня после трансфекции снизилось на ~ 70%. Наши результаты показали поразительное накопление Eqt-SM в TGN и сопутствующее истощение цитоплазматических везикул в нокдаун-клетках SMS1 и SMS2 по сравнению с контрольными клетками siRNA (рис.3 A и Таблица S1).

Рис. 3.

Экспорт Eqt-SM из Гольджи поддерживается синтезом SM. ( A ) Eqt-SM накапливается в Гольджи клеток SMS1 и SMS2 RNAi. Клетки HeLa трансфицировали siRNA в течение 2 дней, затем трансфицировали плазмиды, которые управляют экспрессией Eqt-SM и GalT-mKate2, и визуализировали с помощью флуоресцентной микроскопии деконволюции через 16 часов после второй трансфекции. Ядерную ДНК окрашивали Hoechst 33342. Показаны максимальные проекции серии z.(Масштаб: 10 мкм.) ( B ) Eqt-SM накапливается в Golgi клеток, обработанных D609, низкомолекулярным ингибитором синтеза SM. Клетки HeLa, трансфицированные плазмидами, которые направляют экспрессию Eqt-SM и GalT-mKate2, инкубировали с D609 (200 мкМ) в течение 4 часов. Показаны максимальные проекции z-ряда. (Масштаб: 10 мкм.)

Из-за времени, необходимого РНКи для проявления этого эффекта, и неполного удаления мРНК SMS1 и SMS2, мы дополнили этот эксперимент вторым экспериментом, в котором синтез SM был резко ингибирован с помощью D609. низкомолекулярный ингибитор синтеза SM (33) и других метаболических активностей (34, 35) за 4 часа до визуализации (рис.3 В ). Как и в случае с клетками SMS1 и SMS2 RNAi, мы наблюдали истощение цитоплазматических везикул Eqt-SM (14 ± 8 точек на клетку против 65 ± 14 точек на клетку в контроле). DAG, продуцируемый путем SM, участвует в делении по крайней мере одного класса секреторных везикул, полученных из Гольджи, от TGN (36–38), но, что важно, в количественном определении доли сенсора DAG (PKD-C2), который локализуется в Гольджи в SMS1 и SMS2 RNAi- и D609-обработанных клетках (рис. S3) не показал различий в SMS1 и SMS2 RNAi-клетках (~ 13% в контроле и РНКи-клетках), а только ~ 50% снижение в D609-обработанных клетках. ячеек (до ~ 6%).Эти результаты показывают, что в наших экспериментальных условиях ни один метод полностью не устраняет пул DAG Гольджи.

Рис. S3.

Ингибирование синтеза SM не уничтожает пул DAG Гольджи. DAG был обнаружен в Golgi клеток SMS1 и SMS2 RNAi ( A ) и в Golgi клеток, обработанных D609 ( B ). Клетки трансфицировали плазмидой, которая управляет экспрессией GST-меченного C2 домена протеинкиназы D, биосенсора DAG (37), который детектировали с помощью иммунофлуоресценции против GST.Пропорции флуоресценции PKD_C2, которые локализуются на Гольджи, указаны на каждой микрофотографии (среднее ± стандартное отклонение; n > 20). (Шкала: 10 мкм.)

Мы дополнительно исследовали секреторную способность клеток, обработанных D609, отслеживая доставку CD8α, интегрального мембранного белка за один проход, к плазматической мембране с помощью флуоресцентной микроскопии и биотинилирования клеточной поверхности (рис. S4). Наши результаты показывают, что эффективный экспорт Eqt-SM из Golgi требует постоянного синтеза SM, и в совокупности они подтверждают, что Eqt-SM является внутриклеточным репортером трафика SM.Важно отметить, что Eqt-SM можно использовать для изучения динамики СМ в отсутствие генетических, фармакологических или температурно-индуцированных (27) возмущений, обычно используемых в исследованиях торговли людьми после Гольджи. Мы воспользовались этим, чтобы исследовать перенос нативных SM через Гольджи на плазматическую мембрану.

Рис. S4.

Ингибирование синтеза SM приводит к накоплению GPI в ​​Гольджи. ( A ) Клетки HeLa, экспрессирующие GFP-FM4-GPI или GFP-FM4-CD8α (и Eqt-SM-mKate2), инкубировали с D609 в течение 3 часов перед добавлением молекулы солюбилизатора для высвобождения GPI и CD8α в секреторный путь.В отсутствие дезагрегирующей молекулы ( Left , «без солюбилизатора») GPI или CD8α сохраняется в ER. В отсутствие D609 через 45 мин после добавления дезагрегирующей молекулы ( Center , «+ солюбилизатор») как GPI, так и CD8 локализуются в значительной степени на плазматической мембране. В клетках, инкубированных с D609 в течение 3 часов перед добавлением дезагрегирующей молекулы ( Right , «+ D609 + солюбилизатор»), GPI накапливается в Golgi, тогда как CD8α продолжает доставляться к плазматической мембране.(Масштаб: 10 мкм.) ( B ) Биотинилирование поверхности клеток получали, как описано в A . После инкубации клеток с реагентом для биотинилирования, непроницаемым для мембран, были получены лизаты (показан 1%), и биоинтилированные белки были захвачены на гранулах NeutrAvidin. Захваченные белки разделяли и наблюдали с помощью SDS / PAGE и иммуноблоттинга против GFP. Стрелки указывают положения немодифицированных и секретируемых гликозилированных (гли) форм белков. Блоттинг против актина сообщает о целостности клеток.Указаны стандарты молекулярной массы (кДа).

Eqt-SM сортируется на подмножество секреторных пузырьков, полученных методом Гольджи.

Мы выполнили основанный на TIRFM анализ содержания секреторных везикул, чтобы определить, смещена ли упаковка Eqt-SM и, следовательно, SM в сторону определенного класса везикул. Чтобы гарантировать, что анализы были ограничены экзоцитарными событиями биосинтетического пути (по сравнению, например, с носителями эндосомного пути), флуоресцентные репортерные белки удерживались в эндоплазматическом ретикулуме (ER), а затем высвобождались с использованием системы индуцибельной агрегации белков ( 39), что позволило нам оценить биосинтетическую когорту груза, проходящего секреторный путь.Для этого использовались два разных секретируемых груза, заякоренный белок с гликофосфатидилинозитолом (GPI) и CD8α. GPI был выбран потому, что, как только он доставляется к Гольджи, он связывается с нерастворимыми в детергенте мембранами, такими как мембраны, обогащенные сфинголипидами и холестерином (40). Гликопротеин CD8α на клеточной поверхности был выбран потому, что, в отличие от GPI, он исключен из нерастворимых в детергенте мембран Т-клеток, где он экспрессируется нативно (41, 42).

Мы сконструировали GPI-заякоренный гибридный белок, содержащий сигнальную последовательность, красный флуоресцентный белок (mKate2) и четыре домена условной агрегации F M , за которыми следует сайт акцептора GPI (ss-mKate2-FM4-GPI).Эта конструкция также содержит консенсусный сайт N-гликозилирования, позволяющий оценивать трафик через Гольджи с помощью биохимического анализа (43). Аналогичный по структуре репортерный белок CD8α (ss-mKate2-FM4-CD8α) сравнивали с GPI (44). Эти конструкции вводили в клетки HeLa, экспрессирующие либо Eqt-SM-pHlourin, либо Eqt-sol-pHlourin, и клетки поддерживали в отсутствие реагента дезагрегации («удержание ER»), чтобы ограничить пребывание GPI и CD8 в ER. . При добавлении солюбилизатора D / D (Clontech) оба репортера высвобождались из ER, передавались в аппарат Гольджи, а затем доставлялись к плазматической мембране (рис.4 А ). Экзоцитарные события регистрировали с помощью двухцветной покадровой TIRFM в течение 30–60 минут после добавления дезагрегационного реагента.

Рис. 4.

Eqt-SM и GPI превращаются в секреторные пузырьки. ( A ) Торговля репортерными белками GPI и CD8α. Клетки HeLa трансфицировали плазмидами, которые управляют экспрессией mKate2-FM4-GPI или mKate2-FM4-CD8α. В отсутствие дезагрегирующей молекулы («ER сохранить») mKate2-FM4-GPI и mKate2-FM4-CD8α сохраняются в ER.Инкубация клеток с дезагрегирующей молекулой («высвобождение 45’ ») высвобождает GPI и CD8α из ER, и они впоследствии переносятся на поверхность клетки. На микрофотографиях показаны клетки, инкубированные с солюбилизатором в течение 45 мин. ( B и C ) Пример покадровой галереи TIRFM экзоцитозных событий Eqt-SM, Eqt-sol и GPI ( B ) и mKate2-FM4-CD8α ( C ). Репортеры GPI и CD8α коэкспрессируются в клетках с Eqt-SM-pHlourin или Eqt-sol-pHlourin и высвобождаются из ER клеток путем добавления солюбилизирующего лекарственного средства.Экзоцитарные события регистрировали с помощью TIRFM через 30 мин после выпуска ER. Графики показывают интенсивность флуоресценции в каждом канале во времени. ( D ) Краткое изложение содержания груза в везикулах Eqt и содержания везикул, содержащих GPI. Перечислены пропорции экзоцитарных везикул, содержащих указанные грузы (среднее ± стандартное отклонение). Количество событий слияния, оцененных для каждого состояния, следующее: Eqt-SM + CD8, n = 146; Eqt-SM + GPI, n = 157; Eqt-sol + CD8, n = 153; Eqt-sol + GPI, n = 136; GPI + Eqt-SM, n = 85; GPI + Eqt-sol, n = 65.

Чтобы проанализировать содержание репортерного белка в каждой везикуле, мы количественно оценили экзоцитарные события, используя два критерия. Сначала мы определили пропорции везикул Eqt-SM и Eqt-sol, содержащих GPI или CD8α (рис. 4 B и C ). Результаты показывают, что 72 ± 3% везикул, содержащих Eqt-SM, содержали GPI, тогда как только 34 ± 4% везикул содержали Eqt-SM и CD8α (рис. 4 D ). Напротив, примерно равные пропорции везикул Eqt-sol содержали GPI или CD8α (51 ± 5% и 52 ± 3% соответственно).Напротив, мы рассчитали долю GPI-содержащих везикул, которые содержат Eqt-SM или Eqt-sol (рис. 4 D ). Эти результаты показывают, что 86 ± 5% везикул, содержащих GPI, содержат Eqt-SM, тогда как только 51 ± 1% этих везикул содержат Eqt-sol (рис. 4 D ).

Приведенные выше результаты ясно указывают на предвзятость в содержании Eqt-SM– и, следовательно, SM-, содержащих везикулы, которые также содержат репортер GPI и деобогащены репортером CD8α. Чтобы определить, лежит ли в основе этих смещений сортировка в аппарате Гольджи, мы высвободили репортеры GPI и CD8α из ER клеток, экспрессирующих Eqt-SM, а затем определили долю везикул, содержащих GPI или CD8α, которые отпочковались из везикул Гольджи, содержащих Eqt- SM (рис.5). Эти анализы показали, что 79 ± 0,1% ( n = 33) GPI-содержащих носителей содержали Eqt-SM, по сравнению только с 19 ± 0,1% ( n = 26) CD8α-содержащих носителей. Тесное соответствие этих значений с таковыми из анализов слияния плазматической мембраны указывает на то, что сортировка Eqt-SM и, следовательно, SM, и репортерных белков происходит до выхода из аппарата Гольджи. В качестве дополнительного подтверждения этого вывода, GPI, но не CD8α, накапливался в Golgi обработанных D609 клеток после высвобождения из ER (рис.S4).

Рис. 5.

Eqt-SM и GPI трансформируются в пузырьки, которые отпочковываются от Golgi. ( A ) Покадровые галереи, показывающие примеры открывающихся событий Гольджи. Флуоресцентные белки (mKate2-FM4-GPI или mKate2-FM4-CD8α) высвобождались из ER клеток HeLa, стабильно экспрессирующих Eqt-SM-oxGFP, и получение изображения области Гольджи было начато через 30 минут. Пример везикулы, содержащей как Eqt-SM, так и GPI, показан вверху, а пример везикулы, которая содержит CD8α, но не Eqt-SM, показан ниже.( B ) Покадровая галерея области Гольджи клетки HeLa, экспрессирующей SBP-mKate2-GPI и eGFP-FM4-CD8α, демонстрирующая примеры каждого репортерного белка, экспортируемого из Гольджи в различных носителях. ( C ) Сводная информация о грузе пузырьков, отпочковавшихся от Гольджи. Средние значения ± стандартное отклонение событий почкования Eqt-SM-oxGFP в клетках, экспрессирующих mKate2-FM4-GPI ( n = 33), mKate2-FM4-CD8α ( n = 26) и SBP-mKate2-GPI и eGFP- FM4-CD8α ( n = 69).

Эти результаты привели к предсказанию, что GPI и CD8α экспортируются из Гольджи через разных носителей. Чтобы проверить это, мы сконструировали клетки, чтобы удерживать mKate2-GPI в ​​ER, используя систему удержания с использованием системы селективных крючков (RUSH) (45) и GFP-CD8α, используя метод, основанный на агрегации. Оба репортера были выпущены из ER и прибыли в Golgi, после чего была определена доля носителей, отпочковавшихся из Golgi, содержащих оба белка. В полном соответствии с более ранними результатами, этот анализ показал, что из 69 наблюдаемых почкующихся носителей только 33.3 ± 0,1% содержали репортеры как GPI, так и CD8α (рис. 5).

Оценивая нагрузку груза отдельных секреторных везикул, содержащих биосенсор SM, Eqt-SM, по мере их отпочкования от TGN, и соотнося это с нагрузкой белкового груза отдельных везикул, когда они сливаются с плазматической мембраной, мы предоставляем доказательства того, что SM обогащен отдельным классом секреторных пузырьков. Присутствие Eqt-SM сильно коррелирует с присутствием секретируемого репортерного белка GPI в ​​той же везикуле и антикоррелировано с присутствием CD8α.Предыдущие исследования сортировки и секреции GPI в ​​линии поляризованных эпителиальных клеток были противоречивыми (46, 47), и результаты, представленные здесь, твердо подтверждают точку зрения, что GPI сортируется в отдельный класс секреторных пузырьков, которые отталкиваются от TGN (48, 49). ). Удовлетворительно, они также поддерживают выводы относительно сортировки флуоресцентного церамида в поляризованных эпителиальных клетках (9). Тем не менее, механизм, с помощью которого SM избирательно упаковывается в TGN, остается неизвестным. В простых мембранных системах (например,g., три липидных компонента) при физиологической температуре, SM и холестерин сливаются в «плотоподобную» жидкую упорядоченную фазу (50), и предполагается, что латеральная сегрегация сфинголипида и холестерина вносит вклад в сегрегацию белков, которые имеют внутреннюю сродство к этой липидной среде (51, 52). Однако домены SM / холестерина достаточного размера, чтобы объяснить сортировку секреторных пузырьков, не наблюдались в Гольджи или плазматических мембранах. Альтернативная возможность состоит в том, что пространственное и временное соединение синтеза SM в «биосинтетический домен» дает кинетическое преимущество для обогащения вновь синтезированных SM в отдельный тип транспортного носителя в TGN.Доступность Eqt-SM в качестве реагента для отслеживания SM в клетках должна предоставить новые возможности для исследования метаболизма и перемещения этого важного и обильного липида внутри клетки.

SI Материалы и методы

Манипуляции с ДНК.

Синтетический ген с оптимизированными кодонами, кодирующий последовательность Eqt (кодоны 199-735), был синтезирован Integrated DNA Technologies. Олигонуклеотиды, используемые для секвенирования ДНК и мутагенеза, были синтезированы Лабораторией биотехнологических ресурсов Кека Йельского университета.Для генерации Eqt-SM и Eqt-sol сигнальная последовательность гормона роста человека (аминокислоты 1-26) была помещена перед ORF Eqt (кодоны 199-735), за ней следовал неструктурированный линкер (последовательность: GSAGSAAGSGEFQSTVPRARDP) и OxGFP, mKate2, pHluorin или эпитопная метка 3X FLAG. Последовательности всех новых конструкций были подтверждены секвенированием ДНК. Плазмиды, кодирующие ss-GFP-FM4-CD8α и ss-DsRed-FM4-CD8α, были предоставлены Грегори Лавье, Йельский университет, Нью-Хейвен, Коннектикут (44). Эти плазмиды были модифицированы для замены последовательности CD8α последовательностью GPI.Плазмида, которая управляет экспрессией SBP-eGFP-GPI (45), была модифицирована для замены eGFP на mKate2.

Культура клеток.

клеток HeLa поддерживали в 5% CO 2 при 37 ° C в среде DMEM с добавлением 10% (об. / Об.) FBS (Gibco). Клетки трансфицировали Fugene HD с использованием 0,4 мкг плазмидной ДНК, смешанной с 1,5 мкл Fugene HD (Promega). Все анализы трансфицированных клеток начинали через 16–20 ч после трансфекции.

Для окрашивания трипановым синим раствор, содержащий трипановый синий (0.04%) в PBS добавляли к клеткам и получали фазово-контрастные изображения. Было подсчитано не менее 1000 ячеек из случайно полученных полей для каждого условия. Для эксперимента по гашению клеточной поверхности в среду для визуализации добавляли трипановый синий (0,11%) и сразу получали флуоресцентные изображения.

Для экспериментов с siRNA клетки HeLa подвергали обратной трансфекции 20 нМ ненаправленной контрольной ДНК или 10 нМ каждой siRNA (в сочетании), направленной против SMS1 и SMS2, с использованием липофектамина RNAiMax.Двумя днями позже клетки снова трансфицировали плазмидами экспрессии с использованием Fugene HD, а затем анализировали через 16-20 часов. Последовательности миРНК следующие: SMS1, CTAACACTTACCTACTTATTTATCA; SMS2, CACTATCGATGTGATCATTGCTTAT. Эффективность миРНК определяли с помощью количественной ОТ-ПЦР общей РНК, очищенной реагентами Qiagen RNAeasy. ОТ-ПЦР выполняли с использованием iTaq Universal SYBR Green Supermix (Bio-Rad) и системы обнаружения ПЦР в реальном времени CFX96 Touch (Bio-Rad).

Для ингибирования синтеза SM с помощью D609 (Santa Cruz Biotechnology) клетки HeLa дважды промывали DMEM и затем инкубировали в DMEM, содержащей 200 мкМ D609, в течение 4 часов.Для экспериментов, показанных на фиг. S4, в которых использовалось контролируемое высвобождение GFP-FM4-CD8α и mKate2-FM4-CD8α из ER, клетки инкубировали с D609 в течение 180 мин (37 ° C), после чего солюбилизатор D / D (Clontech ) (1 мкМ) добавляли к среде, и клетки инкубировали еще 40 мин перед фиксацией.

Анализы биотинилирования белков клеточной поверхности проводили с использованием клеток HeLa, инкубированных в среде, содержащей 200 мкМ D609, в течение 3 часов при 37 ° C, после чего добавляли солюбилизатор D / D (1 мкМ) в течение 60 минут.Клетки трижды промывали ледяным PBS (Gibco), а затем инкубировали с EZ-Link Sulfo-NHS-LC-Biotin (1 мг / мл; Thermo Fisher Scientific) в PBS, также содержащем 0,1 мМ CaCl 2 и 0,1 мМ MgCl 2 в течение 40 мин при 4 ° C. Реакции останавливали однократной промывкой клеток PBS и затем добавлением 100 мМ глицина в PBS (с 0,1 мМ CaCl 2 и 0,1 мМ MgCl 2 ) в течение 20 минут при 4 ° C для гашения непрореагировавшего сульфо-NHS-LC-биотина. . После промывания PBS клетки собирали и лизировали PBS, содержащим 2% Nonidet P-40,0.2% SDS и ингибиторы протеазы (Roche, с EDTA) в течение 30 мин с обработкой ультразвуком (10 Вт, 15 импульсов по 1 с). Лизаты центрифугировали в течение 20 минут при 16000 × g , и полученные супернатанты инкубировали с уравновешенной смолой NeutrAvidin Agarose (Thermo Fisher Scientific) в течение ночи при 4 ° C при вращении. Смолу промывали четыре раза PBS, содержащим 2% Nonidet P-40 и 0,2% SDS, кипятили в загрузочном буфере SDS в течение 10 минут перед электрофорезом.

Чтобы пометить клетки HeLa рекомбинантным Eqt, клетки обрабатывали 0.5 ед / мл SMase ( Bacillus cereus ; Sigma-Aldrich) в DMEM в течение 30 минут при 37 ° C, а затем инкубировали с 1 мкМ рекомбинантным Eqt-SM-FLAG или Eqt-sol-FLAG при комнатной температуре в течение 2 минут и фиксируется 2% (об. / об.) PFA. Затем клетки инкубировали с антителами против FLAG (1/500; Sigma-Aldrich) в течение 2 часов и с антителами против мыши Texas red (1/1000) (Life Technologies). Клеточную ДНК окрашивали Hoechst 33342 (Cell Signaling).

Экспрессия рекомбинантного белка и связывание липосом.

белков Eqt экспрессировались в клетках Escherichia coli BL21 (DE3) с N-концевой меткой His из векторов, полученных из pET28a.Клетки выращивали при 37 ° C до OD 600 ∼0,6–0,8, после чего экспрессию белка индуцировали 0,4 мМ изопропил-β-D-1-тиогалактопиранозидом. Клетки собирали через 4 часа после индукции, затем подвергали механическому лизированию в буфере, состоящем из 20 мМ Na 2 HPO 4 / NaH 2 PO 4 , pH 7,4, 500 мМ NaCl и 25 мМ имидазола с добавлением комплемента. Ингибитор протеазы без мини-ЭДТА (Roche) с использованием разрушителя клеток (Avenstin). Очищенные клеточные экстракты наносили на колонку HisTrap с использованием системы жидкостной хроматографии AKTA Prime (GE Healthcare), и связанный Eqt2 и мутанты элюировали градиентом имидазола.

Липосомы, используемые для анализа седиментации везикул, были получены из чистых синтетических липидов (Avanti Polar Lipids или Echelon Biosciences) путем смешивания 60 мольных процентов (80% для липосом, не содержащих SM) диолеоил-фосфатидилхолина, 20 мольных процентов SM (свиного мозга) и 20 молярных процентов холестерина в буфере (10 мМ Hepes и 100 мМ NaCl, pH 6,5) путем экструзии через фильтры с размером пор 1 мкм с использованием мини-экструдера (Avanti Polar Lipids). Для анализа связывания липосомы (2 мМ липида) инкубировали с очищенными белками (10 мкМ) в течение 5 минут при 37 ° C, после чего липосомы собирали центрифугированием при 100000 × g в течение 10 минут при 37 ° C.Супернатанты собирали и осадки суспендировали в равном объеме буфера для образцов. Плотность белковых полос определяли с использованием программного обеспечения Image Lab (Bio-Rad).

Флуоресцентная микроскопия.

Для деконвационной флуоресцентной микроскопии клетки дважды промывали PBS и среду заменяли раствором для визуализации живых клеток (молекулярные зонды). Пакеты трехмерных изображений были собраны с шагом z 0,3 мкм на рабочей станции DeltaVision Elite (Applied Precision) на основе инвертированного микроскопа (IX-70; Olympus) с использованием 60 ×, 1.Масляная иммерсионная линза 4 NA. Изображения были захвачены камерой sCMOS (CoolSnap HQ; Photometrics) и деконволюционированы с помощью softWoRx версии 6.0 с использованием алгоритма с итеративными ограничениями и измеренной функции рассеяния точки. Весь анализ и подготовка изображений выполнялись с использованием ImageJ версии 1.48. Расчеты коэффициентов корреляции Пирсона (рис. S2) были выполнены с использованием softWoRx версии 6.0 с 5% вычитанием фона. При определении корреляций с нерезидентными белками Гольджи перинуклеарная область каждой клетки, содержащей аппарат Гольджи, была замаскирована, чтобы исключить ее из анализа.

События отпочкования везикул Eqt-SM в Golgi отслеживали с использованием линии клеток HeLa с интегрированным, индуцируемым тетрациклином геном Eqt-SM. Клетки трансфицировали плазмидами, экспрессирующими mKate2-FM4-GPI или mKate2-FM4-CD8α, после чего немедленно добавляли тетрациклин (1 мкг / мл). Через 16 ч после трансфекции добавляли солюбилизатор D / D и через 30 мин начинали захват изображения (1 Гц) с использованием рабочей станции DeltaVision.

Для сравнения событий почкования eGFP-FM4-CD8α и SBP-mKate2-GPI плазмиды, которые управляют экспрессией каждого флуоресцентного белка, трансфицировали в клетки HeLa, экспрессирующие крючок Ii-стрептавидина ER (45).Через 16 часов после трансфекции eGFP-FM4-CD8α высвобождается из ER путем добавления D / D солюбилизатора, а через 10 минут SBP-mKate2-GPI высвобождается из ER путем добавления биотина. Захват изображения клеток, экспрессирующих как GPI, так и CD8α, инициировали после еще одной 15-минутной инкубации.

TIRFM был выполнен в соответствии с опубликованным протоколом (53) с использованием микроскопа (IX-70; Olympus), оснащенного лазерными линиями аргона (488 нм) и аргона / криптона (568 нм), конденсатором TIRFM (Olympus или индивидуальный конденсатор), 60 ×, 1.45 NA масляно-иммерсионный объектив (Olympus) и камера EMCCD (iXon887; 0,18 мкм на пиксель, 16 бит; Andor Technology). Система TIRFM контролировалась программным обеспечением iQ (Andor Technology). Клетки HeLa выращивали в чашках MatTek и отображали через 16–20 ч после трансфекции. Все эксперименты проводили при 37 ° C в растворе для визуализации живых клеток (молекулярные зонды), содержащем 10 мМ глюкозы, pH 7,4. Для экспериментов с двухцветным TIRFM канал pHlourin перед съемкой подвергали фотообесцвечиванию для устранения поверхностной флуоресценции Eqt-SM.Клетки визуализировали в одном канале с частотой 5 Гц или в двух каналах путем последовательного возбуждения с частотой 2 Гц.

Анализ слияния везикул, меченных pH-фтором, проводили в соответствии с опубликованным протоколом (54). Вкратце, стеки покадровых изображений были обработаны и проанализированы с помощью ImageJ. Каждый полученный набор изображений просматривался вручную для выявления предполагаемых событий слияния везикул, меченных флюорином. Были отмечены координаты событий слияния, и небольшая область интереса вокруг каждого слияния использовалась для дальнейшего анализа.Круглые области диаметром 4 пикселя использовали для расчета интенсивности одиночных везикул. Для двухцветных TIRFM-изображений канал pHluorin использовался для определения событий слияния и рассчитывалась интенсивность в той же области красного канала. Совместную локализацию белков в одной и той же везикуле определяли на основе профиля слияния интенсивности вместе со стеками изображений. Видео были сжаты в 20 раз с помощью ImageJ в формат AVI с использованием алгоритма JPEG. Никаких нелинейных корректировок для изменения флуоресцентных сигналов не производилось.

Роль внеклеточных везикул в развитии коагулопатии, вызванной сепсисом | Journal of Intensive Care

  • 1.

    Raposo G, Stoorvogel W. Внеклеточные пузырьки: экзосомы, микровезикулы и другие. J Cell Biol. 2013; 200: 373–83.

    CAS PubMed PubMed Central Статья Google Scholar

  • 2.

    Дистлер Дж. Х., Писецкий Д. С., Хубер Л. С., Калден Дж. Р., Гей С., Дистлер О. Микрочастицы как регуляторы воспаления: новые участники межклеточного взаимодействия при ревматических заболеваниях.Ревматоидный артрит. 2005. 52: 3337–48.

    CAS PubMed Статья Google Scholar

  • 3.

    Ньюланд Р., Беркманс Р.Дж., МакГрегор С., Боинг А.Н., Ромейн Ф.П., Вестендорп Р.Г., Хак С.Е., Стурк А. Клеточное происхождение и прокоагулянтные свойства микрочастиц при менингококковом сепсисе. Кровь. 2000; 95: 930–5.

    CAS PubMed Google Scholar

  • 4.

    Ван Дж. Г., Мэнли Д., Кирххофер Д., Павлински Р., Макман Н.Уровни активности тканевого фактора микрочастиц коррелируют с активацией коагуляции у мышей с эндотоксемией. J Thromb Haemost. 2009; 7: 1092–8.

    CAS PubMed PubMed Central Статья Google Scholar

  • 5.

    Тери К., Островски М., Сегура Э. Мембранные везикулы как транспортеры иммунных ответов. Nat Rev Immunol. 2009; 9: 581–93.

    PubMed Статья CAS Google Scholar

  • 6.

    Редман CW, Сарджент Иллинойс. Микрочастицы и иммуномодуляция при беременности. J Reprod Immunol. 2007; 76: 61–7.

    CAS PubMed Статья Google Scholar

  • 7.

    Dignat-George F, Boulanger CM. Многоликость эндотелиальных микрочастиц. Артериосклер Thromb Vasc Biol. 2011; 31: 27–33.

    CAS PubMed Статья Google Scholar

  • 8.

    Groot Kormelink T, Mol S, de Jong EC, Wauben MHM.Роль внеклеточных пузырьков, когда врожденные встречаются с адаптивными. Semin Immunopathol. 2018. https://doi.org/10.1007/s00281-018-0681-1.

  • 9.

    Dvorak HF, Quay SC, Orenstein NS, Dvorak AM, Hahn P, Bitzer AM, et al. Отшелушивание и коагуляция опухолей. Наука. 1981, 212 (4497): 923–4.

    CAS PubMed Статья Google Scholar

  • 10.

    Лейн Р.Э., Корби Д., Хилл М.М., Трау М. Внеклеточные везикулы как циркулирующие биомаркеры рака: возможности и проблемы.Clin Transl Med. 2018; 7: 14.

    CAS PubMed PubMed Central Статья Google Scholar

  • 11.

    Tushuizen ME, Diamant M, Sturk A, Nieuwland R. Микрочастицы клеточного происхождения в патогенезе сердечно-сосудистых заболеваний: друг или враг? Артериосклер Thromb Vasc Biol. 2011; 31: 4–9.

    CAS PubMed Статья Google Scholar

  • 12.

    Морел О., Морел Н., Джесель Л., Фрейсине Дж. М., Тоти Ф.Микрочастицы: важный компонент в связке между воспалением, иммунитетом и тромбозом. Semin Immunopathol. 2011; 33: 469–86.

    CAS PubMed Статья Google Scholar

  • 13.

    Дистлер Дж. Х., Хубер Л. С., Гей С., Дистлер О, Писецкий Д. С.. Микрочастицы как медиаторы межклеточного взаимодействия при воспалительных заболеваниях. Аутоиммунитет. 2006; 39: 683–90.

    CAS PubMed Статья Google Scholar

  • 14.

    Ratajczak J, Wysoczynski M, Hayek F, Janowska-Wieczorek A, Ratajczak MZ. Микровезикулы мембранного происхождения: важные и недооцененные медиаторы межклеточной коммуникации. Лейкемия. 2006; 20: 1487–95.

    CAS PubMed Статья Google Scholar

  • 15.

    Zafrani L, Gerotziafas G, Byrnes C, Hu X, Perez J, Levi C, Placier S, Letavernier E, Leelahavanichkul A, Haymann JP, Elalamy I, Miller JL, Star RA, Yuen PS, Baud L .Кальпастатин контролирует полимикробный сепсис, ограничивая высвобождение микрочастиц прокоагулянта. Am J Respir Crit Care Med. 2012; 185: 744–55.

    CAS PubMed PubMed Central Статья Google Scholar

  • 16.

    Фрейсине Дж. М., Тоти Ф. Формирование микрочастиц прокоагулянта и их свойства. Thromb Res. 2010; 125: S46–8.

    CAS PubMed Статья Google Scholar

  • 17.

    Хорстман Л.Л., Ан Ю.С. Микрочастицы тромбоцитов: широкоугольная перспектива. Crit Rev Oncol Hematol. 1999; 30: 111–42.

    CAS Статья Google Scholar

  • 18.

    Lötvall J, Hill AF, Hochberg F, Buzás EI, Di Vizio D, Gardiner C, Gho YS, Kurochkin IV, Mathivanan S, Quesenberry P, Sahoo S, Tahara H, Wauben MH, Witwer KW, Théry C. Минимальные экспериментальные требования для определения внеклеточных везикул и их функций: заявление о позиции Международного общества внеклеточных везикул.J Внеклеточные везикулы. 2014; 3: 26913.

    PubMed Статья Google Scholar

  • 19.

    van der Pol E, Böing AN, Gool EL, Nieuwland R. Последние разработки в области номенклатуры, наличия, выделения, обнаружения и клинического воздействия внеклеточных везикул. J Thromb Haemost. 2016; 14: 48–56.

    CAS PubMed Статья Google Scholar

  • 20.

    Zipperle J, Schlimp CJ, Holnthoner W, Husa AM, Nürnberger S, Redl H, Schöchl H.Новый анализ коагуляции, включающий прилипшие эндотелиальные клетки в тромбоэластометрии. Thromb Haemost. 2013; 109: 869–77.

    CAS PubMed Статья Google Scholar

  • 21.

    Ridger VC, Boulanger CM, Angelillo-Scherrer A, Badimon L, Blanc-Brude O, Bochaton-Piallat ML, Boilard E, Buzas EI, Caporali A, Dignat-George F, Evans PC, Lacroix R, Lutgens E, Ketelhuth DFJ, Nieuwland R, Toti F, Tunon J, Weber C, Hoefer IE. Микровезикулы в сосудистом гомеостазе и заболеваниях.Позиционный документ Рабочей группы Европейского общества кардиологов (ESC) по атеросклерозу и биологии сосудов. Thromb Haemost. 2017; 117: 1296–316.

    PubMed Статья Google Scholar

  • 22.

    Ardoin SP, Shanahan JC, Писецкий Д.С. Роль микрочастиц в воспалении и тромбозах. Scand J Immunol. 2007; 66: 159–65.

    CAS PubMed Статья Google Scholar

  • 23.

    Равен П., Ципперл Дж., Дрекслер С. Внеклеточные везикулы как маркеры и медиаторы сепсиса. Тераностика. 2018; 8: 3348–65.

    PubMed PubMed Central Статья Google Scholar

  • 24.

    Андерссон Ю., Трейси К.Дж. HMGB1 является терапевтической мишенью для стерильного воспаления и инфекции. Анну Рев Иммунол. 2011; 29: 139–62.

    CAS PubMed PubMed Central Статья Google Scholar

  • 25.

    Коломбо М., Рапосо Г., Тери С. Биогенез, секреция и межклеточные взаимодействия экзосом и других внеклеточных везикул. Annu Rev Cell Dev Biol. 2014; 30: 255–89.

    CAS PubMed Статья Google Scholar

  • 26.

    Иба Т., Леви Дж. Х. Воспаление и тромбоз: роль нейтрофилов, тромбоцитов и эндотелиальных клеток и их взаимодействия в образовании тромба во время сепсиса. J Thromb Haemost. 2017; 16: 231–41.

    PubMed Статья CAS Google Scholar

  • 27.

    Павлински Р., Педерсен Б., Шаббауэр Г., Тенкати М., Хольшер Т., Бойсверт В., Андраде-Гордон П., Франк Р. Д., Макман Н. Роль тканевого фактора и рецепторов, активируемых протеазой, в модели эндотоксемии на мышах. Кровь. 2004; 103: 1342–7.

    CAS PubMed Статья Google Scholar

  • 28.

    Xu H, Ploplis VA, Castellino FJ. Дефицит фактора свертывания VII защищает от острых воспалительных реакций у мышей. J Pathol. 2006; 210: 488–96.

    CAS PubMed Статья Google Scholar

  • 29.

    Мацумото Х., Ямакава К., Огура Х., Ко Т., Мацумото Н., Симадзу Т. Клиническое значение тканевого фактора и двойных положительных микрочастиц CD13 у пациентов с SIRS с травмой и тяжелым сепсисом. Шок. 2017; 47: 409–15.

    CAS PubMed Статья Google Scholar

  • 30.

    Woei-A-Jin FJ, van der Starre WE, Tesselaar ME, Garcia Rodriguez P, van Nieuwkoop C, Bertina RM, van Dissel JT, Osanto S.Активность прокоагулянтного тканевого фактора на микрочастицах связана с тяжестью заболевания и бактериемией при фебрильных инфекциях мочевыводящих путей. Thromb Res. 2014; 133: 799–803.

    CAS PubMed Статья Google Scholar

  • 31.

    Kleinjan A, Böing AN, Sturk A, Nieuwland R. Микрочастицы при сосудистых заболеваниях: как везикулы, воздействующие на тканевой фактор, способствуют патологии и физиологии. Thromb Res. 2012; 130: S71–3.

    PubMed Статья Google Scholar

  • 32.

    Hellum M, Øvstebø R, Brusletto BS, Berg JP, Brandtzaeg P, Henriksson CE. Активность тканевого фактора, связанного с микрочастицами, коррелирует с плазменными уровнями бактериальных липополисахаридов при менингококковом септическом шоке. Thromb Res. 2014; 133: 507–14.

    CAS PubMed Статья Google Scholar

  • 33.

    Мацумото Х., Ямакава К., Огура Х., Ко Т, Мацумото Н., Симадзу Т. Повышенная экспрессия клеточно-специфических поверхностных антигенов на эндотелиальных микрочастицах при индуцированном сепсисом диссеминированном внутрисосудистом свертывании.Шок. 2015; 43: 443–39.

    CAS PubMed PubMed Central Статья Google Scholar

  • 34.

    Дворак Х.Ф., Ван Де Ватер Л., Битцер А.М., Дворак А.М., Андерсон Д., Харви В.С., Бах Р., Дэвис Г.Л., Де Вольф В., Карвалью А.С. Прокоагулянтная активность, связанная с везикулами плазматической мембраны, выделяемыми культивированными опухолевыми клетками. Cancer Res. 1983; 43: 4434–42.

    CAS PubMed PubMed Central Google Scholar

  • 35.

    Zhang Y, Meng H, Ma R, He Z, Wu X, Cao M, Yao Z, Zhao L, Li T, Deng R, Dong Z, Tian Y, Bi Y, Kou J, Thatte HS, Zhou J, Shi J. Циркулирующие микрочастицы, клетки крови и эндотелий индуцируют прокоагулянтную активность при сепсисе за счет воздействия фосфатидилсерина. Шок. 2016; 45: 299–307.

    CAS PubMed Статья PubMed Central Google Scholar

  • 36.

    Tripisciano C, Weiss R, Eichhorn T, Spittler A, Heuser T, Fischer MB, Weber V.Различный потенциал внеклеточных везикул в поддержке образования тромбина: вклад фосфатидилсерина, тканевого фактора и клеточного происхождения. Научный доклад 2017; 7: 6522.

    PubMed PubMed Central Статья CAS Google Scholar

  • 37.

    Qadri SM, Donkor DA, Bhakta V, Eltringham-Smith LJ, Dwivedi DJ, Moore JC, Pepler L, Ivetic N, Nazi I, Fox-Robichaud AE, Liaw PC, Sheffield WP. Экстернализация фосфатидилсерина и прокоагулянтная активация эритроцитов, вызванная пиоцианином, фактором вирулентности Pseudomonas aeruginosa.J Cell Mol Med. 2016; 20: 710–20.

    CAS PubMed PubMed Central Статья Google Scholar

  • 38.

    Walenta KLH, Link A, Friedrich EB, Bohm M. Циркулирующие микрочастицы при септическом шоке. Am J Respir Crit Care Med. 2009; 180: 100.

    PubMed Статья Google Scholar

  • 39.

    Гулд Т.Дж., Ву ТТ, Суистун Л.Л., Двиведи Д.Д., Май Ш., Вайц Джи, Лиав ПК.Внеклеточные ловушки нейтрофилов способствуют образованию тромбина через тромбоцитозависимые и независимые от тромбоцитов механизмы. Артериосклер Thromb Vasc Biol. 2014; 34: 1977–84.

    CAS PubMed Статья PubMed Central Google Scholar

  • 40.

    Alhamdi Y, Toh CH. Роль внеклеточных гистонов при гематологических нарушениях. Br J Haematol. 2016; 173: 805–11.

    CAS PubMed Статья Google Scholar

  • 41.

    Nair RR, Mazza D, Brambilla F, Gorzanelli A, Agresti A, Bianchi ME. Макрофаги, зараженные ЛПС, высвобождают микровезикулы, покрытые гистонами. Фронт Иммунол. 2018; 9: 1463. https://doi.org/10.3389/fimmu.2018.01463.

    Артикул PubMed PubMed Central Google Scholar

  • 42.

    Delabranche X, Quenot JP, Lavigne T, Mercier E, Francois B, Severac F, Grunebaum L, Mehdi M, Zobairi F, Toti F, Meziani F, Boisramé-Helms J. Раннее обнаружение диссеминированного внутрисосудистого свертывания крови во время септического шока: многоцентровое проспективное исследование.Crit Care Med. 2016; 44: e930–9.

    CAS PubMed Статья Google Scholar

  • 43.

    Delabranche X, Stiel L, Severac F, Galoisy AC, Mauvieux L, Zobairi F, Lavigne T, Toti F, Angle’s-Cano E, Meziani F, Zobairi F, Lavigne T, Toti F, Anglès-Cano E, Meziani F, Boisramé-Helms J. Доказательства НЕТоза при диссеминированном внутрисосудистом свертывании, вызванном септическим шоком. Шок. 2017; 47: 313–7.

    CAS PubMed Статья Google Scholar

  • 44.

    Stiel L, Meziani F, Helms J. Активация нейтрофилов во время септического шока. Шок. 2018; 49: 371–84.

    CAS PubMed Статья Google Scholar

  • 45.

    Oehmcke S, Westman J, Malmstrom J, Mörgelin M, Olin AI, Kreikemeyer B, Herwald H. Новая роль прокоагулянтных микровезикул в ранней защите хозяина от Streptococcus pyogenes. PLoS Pathog. 2013; 9: e1003529.

    CAS PubMed PubMed Central Статья Google Scholar

  • 46.

    Liaw PC, Ito T, Iba T, Thachil J, Zeerleder S. DAMP и DIC: роль внеклеточной ДНК и ДНК-связывающих белков в патогенезе DIC. Blood Rev. 2016; 30: 257–61.

    CAS PubMed Статья Google Scholar

  • 47.

    Венеро E, Ceriotti C, Bianchi ME. DAMPs от гибели клеток к новой жизни. Фронт Иммунол. 2015; 6: 422.

    PubMed PubMed Central Статья CAS Google Scholar

  • 48.

    Пугин Дж. Как повреждение тканей вызывает тревогу в иммунной системе и вызывает синдром системной воспалительной реакции. Энн интенсивной терапии. 2012; 2: 27.

    PubMed PubMed Central Статья CAS Google Scholar

  • 49.

    Radic M, Marion T, Monestier M. Нуклеосомы подвергаются воздействию на клеточную поверхность при апоптозе. J Immunol. 2004. 172: 6692–700.

    CAS PubMed Статья Google Scholar

  • 50.

    Weiss R, Gröger M, Rauscher S, Fendl B, Eichhorn T., Fischer MB, Spittler A, Weber V. Дифференциальное взаимодействие внеклеточных везикул, полученных из тромбоцитов, с субпопуляциями лейкоцитов в цельной крови человека. Научный доклад 2018; 8: 6598.

    PubMed PubMed Central Статья CAS Google Scholar

  • 51.

    Delabranche X, Boisrame Helms J, Asfar P, Berger A, Mootien Y, Lavigne T, Grunebaum L, Lanza F, Gachet C, Freyssinet JM, Toti F, Meziani F.Микрочастицы — новые биомаркеры диссеминированной внутрисосудистой коагулопатии, вызванной септическим шоком. Intensive Care Med. 2013; 39: 1695–703.

    CAS PubMed Статья Google Scholar

  • 52.

    Zafrani L, Ince C, Yuen PS. Микрочастицы при сепсисе: цель, канарейка или лекарство? Intensive Care Med. 2013; 39: 1854–6.

    PubMed Статья Google Scholar

  • 53.

    Keshari RS, Silasi R, Popescu NI, Patel MM, Chaaban H, Lupu C, Coggeshall KM, Mollnes TE, DeMarco SJ, Lupu F. Ингибирование комплемента C5 защищает от органной недостаточности и снижает смертность в модели павиана с кишечной палочкой Escherichia coli. сепсис. Proc Natl Acad Sci U S. A. 2017. https://doi.org/10.1073/pnas.1706818114.

    CAS Статья Google Scholar

  • 54.

    Karasu E, Eisenhardt SU, Harant J, Huber-Lang M. Внеклеточные везикулы: пакеты, отправленные с комплементом.Фронт Иммунол. 2018; 9: 721.

    PubMed PubMed Central Статья Google Scholar

  • 55.

    Hirschberger S, Hinske LC, Kreth S. MiRNAs: динамические регуляторы функций иммунных клеток при воспалении и раке. Cancer Lett. 2018; 431: 11–21.

    CAS PubMed Статья Google Scholar

  • 56.

    Иба Т., Мики Т., Хасигучи Н., Табе Ю., Нагаока И. Являются ли нейтрофилы «примадонной» в прокоагулянтном процессе во время сепсиса? Crit Care.2014; 18: 230.

    PubMed PubMed Central Статья Google Scholar

  • 57.

    Stiel L, Delabranche X, Galoisy AC, Severac F, Toti F, Mauvieux L, Meziani F, Boisramé-Helms J. Флуоресценция нейтрофилов: новый индикатор активации клеток во время индуцированной септическим шоком диссеминированной внутрисосудистой коагуляции. Crit Care Med. 2016; 44: e1132–6.

    CAS PubMed Статья Google Scholar

  • 58.

    Mathivanan S, Simpson RJ. ExoCarta. Сборник экзосомальных белков и РНК. Протеомика. 2009; 9: 4997–5000.

    CAS PubMed Статья Google Scholar

  • 59.

    Mortaza S, Martinez MC, Baron-Menguy C, Burban M, de la Bourdonnaye M, Fizanne L, Pierrot M, Calès P, Henrion D, Andriantsitohaina R, Mercat A, Asfar P, Meziani F. Detrimental гемодинамические и воспалительные эффекты микрочастиц, происходящих от крыс с сепсисом.Crit Care Med. 2009; 37: 2045–450.

    CAS PubMed Статья Google Scholar

  • 60.

    Angelillo-Scherrer A. Микрочастицы лейкоцитарного происхождения в сосудистом гомеостазе. Circ Res. 2012; 110: 356–69.

    CAS PubMed Статья Google Scholar

  • 61.

    Kambas K, Chrysanthopoulou A, Vassilopoulos D, Apostolidou E, Skendros P, Girod A, Arelaki S, Froudarakis M, Nakopoulou L, Giatromanolaki A, Sidiropoulos P, Koffa Mrou, Boumpas Droulitis, Boumpas Droulitis, Boumpis Droulitis .Экспрессия тканевого фактора во внеклеточных ловушках нейтрофилов и микрочастиц, полученных из нейтрофилов, в васкулите, ассоциированном с антинейтрофильными цитоплазматическими антителами, может способствовать тромбовоспалению и тромбофилическому состоянию, ассоциированному с заболеванием. Ann Rheum Dis. 2014; 73: 1854–63.

    CAS PubMed Статья Google Scholar

  • 62.

    Chou J, Mackman N, Merrill-Skoloff G, Pedersen B, Furie BC, Furie B. Тканевый фактор микрочастиц, полученных из гемопоэтических клеток, способствует образованию фибрина во время распространения тромба.Кровь. 2004. 104: 3190–7.

    CAS PubMed Статья Google Scholar

  • 63.

    Satta N, Freyssinet JM, Toti F. Значение тромбомодулина моноцитов человека во время везикуляции мембран и после стимуляции липополисахаридом. Br J Haematol. 1997; 96: 534–42.

    CAS PubMed Статья Google Scholar

  • 64.

    Аарон А., Тамари Т., Бреннер Б.Микрочастицы и экзосомы, происходящие из моноцитов, вызывают прокоагулянтное и апоптотическое действие на эндотелиальные клетки. Thromb Haemost. 2008. 100: 878–85.

    CAS PubMed Статья Google Scholar

  • 65.

    Stocker TJ, Ishikawa-Ankerhold H, Massberg S, Schulz C. Маленький, но мощный: тромбоциты как центральные эффекторы защиты хозяина. Thromb Haemost. 2017; 117: 651–61.

    PubMed Статья Google Scholar

  • 66.

    Варон Д., Шай Э. Тромбоциты и их микрочастицы как ключевые игроки в патофизиологических реакциях. J Thromb Haemost. 2015; 13: S40–6.

    CAS PubMed Статья Google Scholar

  • 67.

    Diamant M, Tushuizen ME, Sturk A, Nieuwland R. Клеточные микрочастицы: новые игроки в области сосудистых заболеваний? Eur J Clin Investig. 2004; 34: 392–401.

    CAS Статья Google Scholar

  • 68.

    Мартинес де Л.С., Ронкал С., Кальвайрак О. и др. Синергетический эффект тромбина и лиганда CD40 на экспрессию металлопротеиназы-10 эндотелиального матрикса и образование микрочастиц in vitro и in vivo. Артериосклер Thromb Vasc Biol. 2012; 32: 1477–87.

    Артикул CAS Google Scholar

  • 69.

    Joop K, Berckmans RJ, Nieuwland R, et al. Микрочастицы пациентов с синдромом полиорганной недостаточности и сепсисом поддерживают коагуляцию с помощью нескольких механизмов.Thromb Haemost. 2001; 85: 810–20.

    CAS PubMed Статья Google Scholar

  • 70.

    Мацумото Х., Ямакава К., Огура Х. и др. Повышенная экспрессия клеточно-специфических поверхностных антигенов на эндотелиальных микрочастицах при диссеминированном внутрисосудистом свертывании, вызванном сепсисом. Шок. 2015; 43: 443–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 71.

    Lehner GF, Harler U, Haller VM, Feistritzer C, Hasslacher J, Dunzendorfer S, Bellmann R, Joannidis M. Характеристика микровезикул при септическом шоке с использованием высокочувствительной проточной цитометрии. Шок. 2016; 46: 373–81.

    CAS PubMed Статья Google Scholar

  • 72.

    Zwicker JI. Микрочастицы, несущие тканевой фактор, и рак. Semin Thromb Hemost. 2008; 34: 195–8.

    CAS PubMed Статья Google Scholar

  • 73.

    Брукс М.Б., Тюрк Дж. Р., Герреро А., Нараянан П. К., Нолан Дж. П., Бестеман Е. Г., Уилсон Д. В., Томас Р. А., Фишман К. Э., Томпсон К. Л., Эллингер-Зигельбауэр Х., Пирсон Дж. Б., Полман А., Чианг А. Ю., Шульце А. Э. Несмертельная инъекция эндотоксина: модель гиперкоагуляции на крысах. PLoS One. 2017; 12: e0169976.

    PubMed PubMed Central Статья Google Scholar

  • 74.

    Охучи М., Фуджино К., Кишимото Т., Ямане Т., Хамамото Т., Табата Т., Цудзита И., Мацусита М., Такахаси К., Мацумура К., Эгути Ю.Связь соотношения микрочастиц, полученных из тромбоцитов в плазме, к количеству тромбоцитов с больничной смертностью и диссеминированной внутрисосудистой коагулопатией у пациентов в критическом состоянии. J Atheroscler Thromb. 2015; 22: 773–82.

    CAS PubMed Статья Google Scholar

  • 75.

    Brozna JP. Клеточная регуляция тканевого фактора. Свертывание крови Фибринолиз. 1990; 1: 415–26.

    CAS PubMed Статья Google Scholar

  • 76.

    Osterud B, Flaegstad T. Повышенная активность тканевого тромбопластина в моноцитах пациентов с менингококковой инфекцией: связано с неблагоприятным прогнозом. Thromb Haemost. 1983; 49: 5–7.

    CAS PubMed Статья Google Scholar

  • 77.

    Darbousset R, Thomas GM, Mezouar S, Frère C, Bonier R, Mackman N, Renné T., Dignat-George F, Dubois C, Panicot-Dubois L. Нейтрофилы, положительные по тканевому фактору, связываются с поврежденной эндотелиальной стенкой и инициировать образование тромба.Кровь. 2012; 120: 2133–43.

    CAS Статья Google Scholar

  • 78.

    Егорина Е.М., Совершаев М.А., Олсен Дж.О., Остеруд Б. Гранулоциты не экспрессируют, а приобретают тканевой фактор моноцитарного происхождения в цельной крови: доказательства прямого переноса. Кровь. 2008; 111: 1208–16.

    CAS PubMed Статья Google Scholar

  • 79.

    Schouten M, Wiersinga WJ, Levi M, van der Poll T.Воспаление, эндотелий и коагуляция при сепсисе. J Leukoc Biol. 2008; 83: 536–45.

    CAS PubMed Статья Google Scholar

  • 80.

    Hotchkiss RS, Tinsley KW, Swanson PE, Karl IE. Апоптоз эндотелиальных клеток при сепсисе. Crit Care Med. 2002; 30: S225–8.

    PubMed Статья Google Scholar

  • 81.

    Boos CJ, Mayr FB, Lip GYH, Jilma B. Эндотоксемия усиливает циркуляцию эндотелиальных клеток у людей.J Thromb Haemost. 2006; 4: 2509–11.

    CAS PubMed Статья Google Scholar

  • 82.

    Mutunga M, Fulton B, Bullock R, Batchelor A, Gascoigne A, Gillespie JI, Baudouin SV. Циркулирующие эндотелиальные клетки у больных септическим шоком. Am J Respir Crit Care Med. 2001. 163: 195–200.

    CAS PubMed Статья Google Scholar

  • 83.

    Огура Х, Танака Х, Ко Т, Фудзита К., Фудзими С., Накамори Й, Хосоцубо Х, Кувагата Й, Симадзу Т, Сугимото Х.Повышенное производство эндотелиальных микрочастиц с повышенным связыванием с лейкоцитами у пациентов с тяжелым синдромом системного воспалительного ответа. J Trauma. 2004; 56: 823–30.

    PubMed Статья Google Scholar

  • 84.

    Hamilton KK, Hattori R, Esmon CT, Sims PJ. Белки комплемента C5b-9 вызывают образование пузырьков в плазматической мембране эндотелия и открывают каталитическую поверхность для сборки ферментного комплекса протромбиназы.J Biol Chem. 1990; 265: 3809–14.

    CAS PubMed Google Scholar

  • 85.

    Rubin O, Delobel J, Prudent M, Lion N, Kohl K, Tucker EI, Tissot JD, Angelillo-Scherrer A. Микрочастицы, полученные из эритроцитов, выделенные из единиц крови, инициируют и размножают образование тромбина. Переливание. 2013; 53: 1744–54.

    CAS PubMed Статья Google Scholar

  • 86.

    Agouti I, Cointe S, Robert S, Judicone C, Loundou A, Driss F, Brisson A, Steschenko D, Rose C, Pondarré C, Bernit E, Badens C, Dignat-George F, Lacroix R, Thuret I. неэритроцитарные микрочастицы являются прокоагулянтом у перелитых пациентов с большой талассемией. Br J Haematol. 2015; 171: 615–24.

    CAS PubMed Статья Google Scholar

  • 87.

    Sewify EM, Sayed D, Abdel Aal RF, Ahmad HM, Abdou MA. Увеличение количества циркулирующих микрочастиц эритроцитов (RMP) и микрочастиц тромбоцитов (PMP) при иммунной тромбоцитопенической пурпуре.Thromb Res. 2013; 131: e59–63.

    CAS PubMed Статья Google Scholar

  • 88.

    Koshiar RL, Somajo S, Norström E, Dahlbäck B. Микрочастицы, полученные из эритроцитов, поддерживающие активированную протеин C-опосредованную регуляцию свертывания крови. PLoS One. 2014; 9: e104200.

    PubMed Статья CAS Google Scholar

  • 89.

    Yuana Y, Böing AN, Grootemaat AE, van der Pol E, Hau CM, Cizmar P, Buhr E, Sturk A, Nieuwland R.Обработка и хранение жидкостей человеческого тела для анализа внеклеточных пузырьков. J Внеклеточные везикулы. 2015; 4: 29260.

    PubMed Статья CAS Google Scholar

  • 90.

    Jy W, Horstman LL, Jimenez JJ, Ahn YS, Biró E, Nieuwland R, Sturk A, Dignat-George F, Sabatier F, Camoin-Jau L, Sampol J, Hugel B, Zobairi F, Freyssinet JM, Nomura S, Shet AS, Key NS, Hebbel RP. Измерение циркулирующих микрочастиц клеточного происхождения. J Thromb Haemost.2004; 2: 1842–51.

    CAS PubMed Статья Google Scholar

  • 91.

    Бард М.П., ​​Хегманс Дж. П., Хеммес А., Людер Т.М., Виллемсен Р., Северийнен Л.А., ван Меербек Дж. П., Бюргерс С.А., Хугстеден ХК, Ламбрехт Б.Н. Протеомный анализ экзосом, выделенных из злокачественных плевральных выпотов человека. Am J Respir Cell Mol Biol. 2004. 31: 114–21.

    CAS PubMed Статья Google Scholar

  • 92.

    van der Vlist EJ, Nolte-‘t Hoen EN, Stoorvogel W, Arkesteijn GJ, Wauben MH. Флуоресцентная маркировка наноразмерных везикул, высвобождаемых клетками, и последующий количественный и качественный анализ с помощью проточной цитометрии высокого разрешения. Nat Protoc. 2012; 7: 1311–26.

    PubMed Статья CAS Google Scholar

  • 93.

    Ford T, Graham J, Rickwood D. Йодиксанол: неионогенная изоосмотическая среда для центрифугирования для образования самогенерируемых градиентов.Анальная биохимия. 1994; 220: 360–6.

    CAS PubMed Статья Google Scholar

  • 94.

    van der Pol E, Sturk A, van Leeuwen T., Nieuwland R, Coumans F. Стандартизация измерений внеклеточных везикул с помощью проточной цитометрии через приближение диаметра везикул. J Thromb Haemost. 2018; 16: 1236–45.

    CAS PubMed Статья Google Scholar

  • 95.

    Стин HB.Проточный цитометр для измерения светорассеяния вирусных и других субмикроскопических частиц. Цитометрия А. 2004; 57: 94–9.

    PubMed Статья Google Scholar

  • 96.

    Simonsen JB. Метод калибровки размера на основе липосом для измерения микровезикул с помощью проточной цитометрии. J Thromb Haemost. 2016; 14: 186–90.

    CAS PubMed Статья Google Scholar

  • 97.

    Perez-Pujol S, маркер PH, ключ NS. Микрочастицы тромбоцитов неоднородны и сильно зависят от механизма активации: исследования с использованием нового цифрового проточного цитометра. Цитометрия А. 2007; 71: 38–45.

    PubMed Статья Google Scholar

  • 98.

    Mooberry MJ, Bradford R, Hobl EL, Lin FC, Jilma B, Key NS. Микрочастицы прокоагулянта способствуют свертыванию в зависимости от фактора XI при эндотоксемии человека. J Thromb Haemost.2016; 14: 1031–42.

    CAS PubMed PubMed Central Статья Google Scholar

  • 99.

    Enjeti AK, Ariyarajah A, D’Crus A, Seldon M, Lincz LF. Корреляционный анализ отслеживания наночастиц, проточной цитометрии и функциональных измерений циркулирующих микровезикул у нормальных субъектов. Thromb Res. 2016; 145: 18–23.

    CAS PubMed Статья Google Scholar

  • 100.

    Thaler J, Ay C, Weinstabl H, Dunkler D, Simanek R, Vormittag R, Freyssinet JM, Zielinski C, Pabinger I. Циркулирующие микрочастицы прокоагулянта у онкологических больных. Ann Hematol. 2011; 90: 447–53.

    PubMed Статья PubMed Central Google Scholar

  • 101.

    Shaver CM, Woods J, Clune JK, Grove BS, Wickersham NE, McNeil JB, Shemancik G, Ware LB, Bastarache JA. Уровни циркулирующих микрочастиц снижены у пациентов с ОРДС.Crit Care. 2017; 21: 120.

    PubMed PubMed Central Статья Google Scholar

  • 102.

    Osumi K, Ozeki Y, Saito S, Nagamura Y, Ito H, Kimura Y, Ogura H, Nomura S. Разработка и оценка иммуноферментного анализа микрочастиц, полученных из тромбоцитов. Thromb Haemost. 2001; 85: 326–30.

    CAS PubMed Статья Google Scholar

  • 103.

    Nomura S, Uehata S, Saito S, Osumi K, Ozeki Y, Kimura Y.Иммуноферментный анализ микрочастиц тромбоцитов и RANTES при остром коронарном синдроме. Thromb Haemost. 2003. 89: 506–12.

    CAS PubMed Статья Google Scholar

  • 104.

    Boisrame-Helms J, Delabranche X, Degirmenci SE, Zobairi F, Berger A, Meyer G, Burban M, Mostefai HA, Levy B, Toti F, Meziani F. Фармакологическая модуляция микрочастиц прокоагулянта улучшает гемодинамическую дисфункцию септический шок у крыс.Thromb Haemost. 2014; 111: 154–64.

    CAS PubMed Статья Google Scholar

  • 105.

    Levi M. Рекомбинантный растворимый тромбомодулин: коагуляция дает еще один шанс снизить смертность от сепсиса. J Thromb Haemost. 2015; 13: 505–7.

    CAS PubMed Статья Google Scholar

  • 106.

    Леви М., ван дер Полл Т. Повреждение эндотелия при сепсисе. Intensive Care Med.2013; 39: 1839–42.

    PubMed Статья Google Scholar

  • 107.

    Ито Т., Маруяма И. Тромбомодулин: Бог-протекторат сосудистой сети при тромбозах и воспалениях. J Thromb Haemost. 2011; 9: 168–73.

    CAS PubMed Статья PubMed Central Google Scholar

  • 108.

    Li YH, Kuo CH, Shi GY, Wu HL. Роль лектинподобного домена тромбомодулина в воспалении.J Biomed Sci. 2012; 19:34.

    PubMed PubMed Central Статья CAS Google Scholar

  • 109.

    Esmon CT. Взаимодействие между воспалением и коагуляцией. Br J Haematol. 2005; 131: 417–30.

    CAS PubMed Статья PubMed Central Google Scholar

  • 110.

    Helms J, Clere-Jehl R, Bianchini E, Le Borgne P, Burban M, Zobairi F, Diehl JL, Grunebaum L, Toti F, Meziani F, Borgel D.Тромбомодулин способствует фибринолитической активности микровезикул лейкоцитов, снижает НЕТоз и предотвращает коагулопатию, вызванную септическим шоком у крыс. Энн интенсивной терапии. 2017; 7: 118.

    PubMed PubMed Central Статья CAS Google Scholar

  • 111.

    Essandoh K, Yang L, Wang X и др. Блокада образования экзосом с помощью GW4869 ослабляет вызванное сепсисом воспаление и сердечную дисфункцию. Biochim Biophys Acta. 2015; 1852: 2362–237.

    CAS PubMed PubMed Central Статья Google Scholar

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie.Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Rho-киназа ускоряет эндоцитоз синаптических пузырьков, связывая активность циклической GMP-зависимой протеинкиназы с синтезом фосфатидилинозитол-4,5-бисфосфата

    Abstract

    Rho-kinase играет различные роли в подвижности клеток. Во время развития нейронов Rho-киназа участвует в миграции нейронов, а также в росте и ретракции нейритов. Rho-киназа остается высоко экспрессированной в зрелых нейронах, но ее физиологические роли плохо изучены. Здесь мы сообщаем, что Rho-kinase играет ключевую роль в системе рециклинга синаптических пузырьков в пресинаптических окончаниях.Везикулы, потребляемые чрезмерным экзоцитозом, пополняются за счет ускорения эндоцитоза везикул через механизм ретроградной обратной связи, включающий оксид азота, высвобождаемый из постсинаптических клеток. Эта система гомеостатического контроля включает пресинаптическую циклическую GMP-зависимую протеинкиназу (PKG) и фосфолипид плазматической мембраны, фосфатидилинозитол-4,5-бисфофат (PIP 2 ). Мы обнаружили, что применение ингибитора Rho-киназы, ингибитора PKG или того и другого снижает содержание PIP 2 в синаптосомах ствола мозга крыс Wistar в аналогичной степени.Аналогично, нанесение ингибитора Rho-киназы на чашечку пресинаптического терминального конца Held замедляло эндоцитоз везикул в той же степени, что и применение ингибитора PKG. Этот замедляющий эндоцитоз эффект ингибитора Rho-киназы был отменен совместным нанесением PIP 2 на терминал. Напротив, активатор RhoA увеличивал содержание PIP 2 и обращал действие ингибитора PKG в синаптосомах ствола мозга. Активатор RhoA при загрузке в терминалы чашечек также устранял замедляющий эндоцитозный эффект ингибитора PKG.Кроме того, интратерминальная нагрузка антитела против PIP 2 замедляла эндоцитоз везикул и блокировала спасительный эффект активатора RhoA. Мы пришли к выводу, что Rho-киназа связывает пресинаптическую активность PKG с синтезом PIP 2 , тем самым контролируя гомеостатический баланс экзоцитоза и эндоцитоза везикул в нервных окончаниях.

    Введение

    В химических синапсах потенциал действия, достигающий нервного окончания, вызывает приток Ca 2+ в клетку, тем самым запуская экзоцитарное высвобождение нейромедиатора путем слияния мембран синаптических везикул с плазматической мембраной терминала.После высвобождения нейротрансмиттера мембрана везикул извлекается из плазматической мембраны путем эндоцитоза, и новые везикулы реформируются и наполняются нейромедиатором, чтобы повторно использовать их в другом раунде синаптической передачи (Schweizer and Ryan, 2006; Jung and Haucke, 2007; Royle and Lagnado, 2010).

    Клатрин-опосредованный эндоцитоз является основным путем рециркуляции пузырьков (Granseth et al., 2006; Jung and Haucke, 2007; Dittman and Ryan, 2009; Haucke et al., 2011). При клатрин-опосредованном эндоцитозе комплекс адаптерных белков 2 связывается с клатрином, синаптотагмином и стонином 2 вместе с фосфатидилинозитол-4,5-бисфофатом (PIP 2 ) в плазматической мембране, чтобы способствовать образованию клатриновой оболочки (McPherson et al. ., 1996; Jost et al., 1998; Ито и др., 2001; Диттман и Райан, 2009 г .; Ройл и Лагнадо, 2010; Haucke et al., 2011). Считается, что PIP 2 также участвует в отслаивании клатрина (Cremona et al., 1999). Более того, PIP 2 связывается с GTPase Dynamin, возможно, способствуя инвагинации канальцев и образованию пузырьков (Zheng et al., 1996). В синапсах гиппокампа в культуре (Micheva et al., 2003) и в чашечке синапсов Held в срезах ствола мозга грызунов (Eguchi et al., 2012) ретроградная активация циклической GMP-зависимой протеинкиназы (PKG) оксидом азота (NO) высвобождается из постсинаптических клеток, ускоряет эндоцитоз везикул за счет повышения уровня PIP 2 в пресинаптическом окончании.Однако неизвестно, как PKG связан с PIP 2 .

    Rho-киназа представляет собой образующую спиральную спираль серин / треонин протеинкиназу и главный эффектор малой GTPase RhoA. Rho-киназа участвует в подвижности клеток, такой как миграция и пролиферация, а также в выживании клеток (Riento and Ridley, 2003; Mueller et al., 2005). В нейронах Rho-киназа способствует разрастанию нейритов (Bito et al., 2000) и ретракции нейритов (Nakayama et al., 2000; Riento and Ridley, 2003; Mueller et al., 2005; Sunico et al., 2010). В синапсах активность Rho-kinase, по сообщениям, участвует в высвобождении медиатора (González-Forero et al., 2012) и в пресинаптической пластичности (Ota et al., 2010). Каскад передачи сигналов NO / PKG усиливает экспрессию RhoA в сосудистой ткани (Sauzeau et al., 2003). Сообщается, что в клеточных линиях RhoA усиливает продукцию PIP 2 из PIP путем активации фосфатидилинозитол-5-фосфаткиназ (PIP5K) (Shibasaki et al., 1997; Weernink et al., 2000, 2004).

    Связывает ли Rho-киназа активность PKG с синтезом PIP 2 в пресинаптическом конце? Мы рассмотрели этот вопрос, используя измерения емкости мембраны чашечки пресинаптических окончаний Held в срезах ствола мозга крыс, вместе с количественной масс-спектрометрией и анализами ELISA содержания PIP 2 в синаптосомах ствола мозга.Наши результаты показали физиологическую роль Rho-киназы в гомеостатическом контроле рециклинга синаптических везикул путем связывания активности PKG с пресинаптическими уровнями PIP 2 .

    Материалы и методы

    Все эксперименты проводились в соответствии с рекомендациями Японского физиологического общества и правилами проведения экспериментов на животных в Окинавском институте науки и технологий аспирантуры.

    Материалы.

    Ингибитор Rho-киназы, транс-4 — [(1 R ) -1-аминоэтил] -N -4-пиридинилциклогексанкарбоксамид дигидрохлорид (Y27632) и натриевая соль 1-α-фосфатидилинозитол 4,5-дифосфат из бычий мозг (PIP 2 ) был получен от Sigma-Aldrich.Аммониевая соль 1-α-фосфатидилинозитол-4-фосфата из свиного мозга (PIP) была приобретена у Avanti Polar Lipids. Ингибитор PKG гуанозин 3 ‘, 5’-циклический монофосфоротиоат, β-фенил-1, N 2 -этено-8-бром-, Rp-изомер, натриевая соль (Rp-cGMPS) был от Calbiochem. Цитотоксический некротический фактор (CNF), производный от каталитического домена белка, активатор Rho II был из цитоскелета. Мышиное моноклональное антитело против PIP 2 было от Abcam.

    Биохимия.

    Для выделения синаптосом и экстракции фосфолипидов стволы головного мозга выделяли у 13-15 крыс линии Wistar в постнатальный день (P) любого пола, умерщвленных декапитацией под наркозом галотаном.После выделения ткани ствола мозга инкубировали с лекарствами или без них в течение 5, 15 или 60 мин при 37 ° C в искусственной спинномозговой жидкости (aCSF), содержащей следующее (в мм): 125 NaCl, 2,5 KCl, 1 MgCl 2 , 2 CaCl 2 , 10 глюкоза, 3 мио-инозитол, 2 пируват натрия, 0,5 аскорбиновой кислоты, 1,25 NaH 2 PO 4 , 26 NaHCO 3 (310–315 мОсм, pH 7,3, при насыщении 95% O 2 /5% CO 2 ). Синаптосомы выделяли, как описано ранее (Villasana et al., 2006). Вкратце, ткани гомогенизировали в 0,32 мкл сахарозы, 4 мМ буфера HEPES-NaOH (pH 7,3, поддерживаемого при <4 ° C), с добавлением коктейля из ингибиторов протеазы без ЭДТА (Roche), коктейля из ингибиторов фосфатаз 3 (Sigma-Aldrich) и ингибитор киназ ортованадат натрия (Sigma-Aldrich). Затем отфильтрованные гомогенаты осветляли 15-минутным центрифугированием при 10 200 × g. Для экстракции кислых фосфатидиллипидов к оставшимся осадкам ткани добавляли охлажденную на льду смесь метанол / хлороформ / HCl 12N (80/40/1), тщательно перемешивали и центрифугировали при 1500 об / мин в течение 5 мин.Добавляли смесь неполярного / полярного растворителя хлороформ / 0,1 н. HCl (1/2), чтобы создать разделение фаз для отделения липидов от водорастворимых компонентов. Фосфолипиды собирали и упаривали с использованием вакуумной центрифуги (Concentrator 5301, Eppendorf). Для количественного определения PIP 2 с помощью ELISA образцы липидов растворяли в PBS, содержащем датчик PIP 2 , входящий в набор PI (4,5) P 2 Mass ELISA (K-4500, Echelon). Затем содержание PIP 2 в каждом образце определяли количественно в соответствии с инструкциями производителя.Люминометрический анализ выполняли путем измерения окончательного поглощения сигнала при 450 нм с использованием считывающего устройства для микропланшетов (Benchmark Plus 170–6930J1, Bio-Rad). Уровни PIP 2 были нормализованы к сырому весу ткани ствола мозга. Для количественного определения фосфолипидов инозитола с помощью масс-спектрометрии образцы липидов разбавляли изопропанолом / ацетонитрилом (60/40, об. / Об.). После смешивания 10 мкл разбавленного образца с 10 мкл матрицы полугидрата 9-аминоакридина (Acros Organics), приготовленной с концентрацией 10 мг / мл, растворенной в изопропаноле / ацетонитриле, 0.5 мкл смеси наносили на пластину из нержавеющей стали MALDI Opti-TOF (Applied Biosystems). MALDI-ToF MS и MS / MS анализы выполняли с использованием масс-спектрометра QSTAR Elite QqTOF, оснащенного импульсным лазером Nd / YAG с частотой 1 кГц (355 нм) и электростатическим зеркалом (Applied Biosystems). Данные были получены в режиме рефлектрона отрицательных ионов при ускоряющем потенциале -15 кВ. Спектры фосфолипидов и отношения сигнал / шум определяли с использованием программного обеспечения Analyst QS 2.0 (Applied Biosystems). Интегрированные площади липидных пиков были скорректированы относительно площадей пиков внутренних стандартов (давая соотношение отклика для каждого липида) и нормализованы по внешнему стандарту, фосфатидилглицерину, PG (18: 0/18: 0), добавленному во время процедуры экстракции липидов (Avanti Polar Липиды).Для очистки антитела против PIP 2 азид натрия и сыворотку новорожденного теленка удаляли с использованием набора для очистки антител Protein A (Abcam) в соответствии с инструкциями производителя.

    Электрофизиология.

    Способы получения срезов слухового ствола мозга, содержащих медиальные ядра трапециевидных тел крыс Wistar (P13-P15), были описаны ранее (Yamashita et al., 2010; Eguchi et al., 2012). Вкратце, крыс умерщвляли обезглавливанием под анестезией галотаном.Перед записью срезы ствола мозга инкубировали при 37 ° C в течение 1 ч в aCSF. Измерения мембранной емкости проводили из чашечки пресинаптических окончаний Held в цельноклеточной конфигурации при 26–27 ° C (Yamashita et al., 2010; Eguchi et al., 2012). Для записи aCSF содержал 10 мМ тетраэтиламмонийхлорида, 0,5 мМ 4-аминопиридина, 1 мкМ тетродотоксина, 10 мкМ бикукуллина метиодида и 0,5 мкМ стрихнина гидрохлорида. Раствор для пипетки содержал 118 мМ глюконата Cs, 30 мМ CsCl, 10 мМ HEPES, 0.5 мМ EGTA, 1 мМ MgCl 2 , 12 мМ динатрийфосфокреатин, 3 мМ Mg-ATP и 0,3 мМ Na-GTP (pH 7,3–7,4, скорректированный с помощью CsOH, 315–320 мОсм). Данные были получены с частотой дискретизации 100 кГц с использованием усилителя патч-зажима EPC-10, управляемого программным обеспечением PatchMaster (HEKA Elektronik), после фильтрации в режиме онлайн на частоте 5 кГц. Выводы чашечки фиксировали напряжением при удерживающем потенциале -80 мВ, и одноступенчатую деполяризацию (до +10 мВ, 20 мс) использовали для индукции пресинаптических токов Ca 2+ (I Ca ).Лекарства вводили из пипеток для цельноклеточных клеток в окончание чашечки путем диффузии. Были приняты меры для поддержания сопротивления доступа <14 МОм для обеспечения диффузии лекарств в терминал в течение 4 минут после разрыва мембраны. Данные были проанализированы с помощью IGOR Pro 6 (WaveMetrics). Все значения даны как среднее ± SEM. Различия считались статистически значимыми при p <0,05 в непарном тесте Стьюдента t или ANOVA с тестом Tukey ad hoc .

    Результаты

    Подавляющее действие ингибитора Rho-киназы на содержание PIP

    2 в синаптосомах ствола мозга

    Уровень PIP 2 в ткани ствола мозга и в чашечках Held крыс после появления слуха может быть снижен путем применения акцептора NO или ингибитора PKG (Eguchi et al., 2012). Чтобы проверить, участвует ли Rho-киназа в этом сигнальном пути, мы исследовали уровень PIP 2 в синаптосомах ствола мозга после применения специфического для Rho-киназы ингибитора Y27632 (Uehata et al., 1997) с помощью ELISA и масс-спектрометрии. Инкубация синаптосом ствола мозга с Y27632 (4 мкм) в течение 15 минут при 37 ° C снижала содержание PIP 2 от двух до трех раз в анализах ELISA (рис. 1 A ) и масс-спектрометрии (рис. 1 B ). . Аналогичным образом, ингибитор PKG Rp-cGMPS (3 мкм), инкубированный с синаптосомами ствола мозга в течение 15 минут при 37 ° C, снижал содержание PIP 2 в ELISA (рис.1 A ) и масс-спектрометрических анализов (рис. 1 B ), как ранее сообщалось для экспериментов ELISA экстрактов ткани ствола мозга (Eguchi et al., 2012). Совместное применение Y27632 (4 мкм) и Rp-cGMPS (3 мкм) не привело к дальнейшему снижению содержания PIP 2 (рис.1 A , B ), что позволяет предположить, что PKG и Rho-киназа действуют последовательно в активация сигнального пути PIP 2 . Ингибирующий эффект Y27632 оказался неожиданно селективным для PIP 2 (1045 Да) с небольшим влиянием на уровни предшественников фосфатидилинозитола (PI) (885 Да), фосфатидилинозитолмонофосфата (PIP) (965 Да) или последующий продукт фосфатидилинозитол-трифосфат (PIP 3 ) (1125 Да) в тандемном масс-спектрометрическом анализе (рис.1 C , D ; см. обсуждение ниже).

    Рисунок 1. Ингибитор

    Rho-киназы снижает уровень PIP 2 в синаптосомах ствола мозга. Уровни PI (4,5) P 2 в синаптосомах ствола мозга определяли с помощью ELISA ( A ) и тандемной масс-спектрометрии ( B ). Ткань ствола мозга инкубировали с Y27632 (4 мкм) или / и с Rp-cGMPS (3 мкм) в течение 15 мин при 37 ° C. C . Проведен анализ ингибирующего действия Y27632 (4 мкм) на уровни PI, PIP, PIP 2 и PIP 3 (m / z 885, 965, 1045 и 1125 Да соответственно). с использованием тандемной масс-спектрометрии. D , Типичные профили масс-спектрометрии кислых липидов из контрольных синаптосом ствола мозга крыс и тканей, обработанных Y27632 ( n = 6). NS, не имеет значения. ** p <0,01.

    Ингибирующее действие ингибитора Rho-киназы на эндоцитоз везикул в чашечке пресинаптического конца Held

    В чашечках Held развивающихся крыс экспрессия PKG увеличивается, а PKG ускоряет эндоцитоз везикул через PIP 2 -зависимый механизм после появления слуха (Eguchi et al., 2012). Чтобы проверить, может ли Rho-киназа участвовать в этом механизме, мы загрузили Y27632 (10 мкм) непосредственно в терминалы чашечки из пипеток для цельноклеточных пластырей (рис. 2 A , B ). Деполяризующие импульсы (от -80 до +10 мВ) длительностью 20 мс вызвали скачок экзоцитоза ΔC m на ∼0,4 пФ, за которым последовал более медленный эндоцитарный распад, с полупериодом (τ 0,5 ) 9,25 ± 0,51. с ( n = 6). Нагрузка Y27632 значительно замедляла эндоцитоз τ 0,5 до 13.9 ± 0,42 с ( n = 10), не влияя на экзоцитарную амплитуду ΔC m или I Ca (рис.2 A , B ).

    Рисунок 2. Ингибитор

    Rho-киназы замедляет эндоцитоз везикул через путь PKG / PIP 2 в чашечке синапсов Held. Изменение емкости мембраны (C m ) вызвано деполяризующим импульсом длительностью 20 мс (от -80 до +10 мВ). A , Прямая инъекция Y27632 (10 мкм) в окончание чашечки (красный след и столбцы) значительно замедлила эндоцитоз.Эффект одновременного размещения Y27632 и Rp-cGMPS (3 мкм) (синий) в чашечках был неотличим от эффекта одного Y27632 (красный). Усредненные трассы C м записей получены с 6–10 терминалов. Сводные гистограммы влияния Y27632 на время полураспада эндоцитов, величины изменения экзоцитов C m (ΔC m ) и амплитуду тока Ca 2+ (I Ca ). B , PIP 2 (5 мкм), при совместном использовании с Y27632, избавил от замедляющего эффекта последнего (синяя кривая, наложенная).Гистограммы такие же, как в A . Напротив, PIP (5 мкм) не имел такого эффекта (зеленый). C , C m изменения, вызванные серией деполяризующих импульсов длительностью 20 мс (20 раз) при 20 Гц в присутствии 0,5 мм EGTA (контроль, черный), 10 мм EGTA (красный) или 10 мм EGTA и 5 мкм PIP 2 (синий), окрашенные в терминалы чашечки P13 – P14. Следы усреднены C m записей, полученных с 6–10 терминалов, нормализованных на пике. Гистограммы представляют время полураспада эндоцитов.* p <0,05. ** p <0,01.

    Как и в биохимических анализах (рис. 1), добавление Rp-cGMPS (3 мкм) и Y27632 (10 мкм) в чашечки не оказало большего влияния, чем их индивидуальные нагрузки на эндоцитоз τ 0,5 (13,5 ± 1,67 с, n = 10) (Fig. 2 A ), предполагая, что Rho-киназа действует ниже PKG по тому же пути, а не по параллельному пути. В отличие от применяемого в ванне ингибитора Rho-киназы в гиппоглоссальных синапсах (González-Forero et al., 2012), Y27632, непосредственно загруженный в пресинаптический терминал чашечки, не влиял на токи ΔC m или Ca 2+ (I Ca ), связанные с высвобождением трансмиттера (Рис. 2 A ).

    Замедляющее действие ингибитора Rho-киназы на эндоцитоз везикул было обращено совместным нанесением PIP 2 (5 мкм) на окончание чашечки (рис. 2 B ), что свидетельствует о снижении эндогенного PIP 2 за счет Ингибитор Rho-киназы может быть спасен экзогенной загрузкой PIP 2 в пресинаптические окончания.Напротив, интратерминальная загрузка PIP-предшественника PIP 2 вместе с Y27632 не имела эффекта, что позволяет предположить, что последний ингибирует PIP5K для продукции PIP 2 из PIP. Кроме того, загрузка PIP 2 не влияла на эндоцитоз везикул, замедленный хелатором Ca 2+ EGTA (10 мм) (Yamashita et al., 2010), что позволяет предположить, что он не оказывает общего спасающего эффекта на скорость эндоцитоза везикул. (Рис.2 C ). Эти результаты вместе с отсутствием эффекта от нагрузки только PIP 2 на скорость эндоцитоза (Eguchi et al., 2012), предполагают, что экзогенный PIP 2 может быть включен в механизм ускорения эндоцитов ниже каскада Rho-kinase, только когда уровень эндогенного PIP 2 снижается, тем самым снижая скорость эндоцитоза синаптических везикул (см. Ниже).

    Активатор Rho-киназы противодействовал негативным регуляторным эффектам ингибитора PKG на уровне PIP

    2 в синаптосомах ствола мозга и на скорость эндоцитоза везикул

    Затем мы исследовали эффект активации Rho-киназы с использованием производного цитотоксического некротического фактора (CNF) пептида Rho activator II (Flatau et al., 1997). Инкубация синаптосом ствола мозга с активатором Rho II (5 мкг / мл, 15 мин при 37 ° C) значительно увеличивала содержание синаптосомного PIP 2 и противодействовала ингибирующему эффекту ингибитора PKG, Rp-cGMPS (3 мкм), в ELISA (Рис. 3 A ) и тандемные масс-спектрометрические анализы (Рис. 3 B ). Эти результаты, вместе с результатами ингибитора Rho-киназы (рис. 1), убедительно свидетельствуют о том, что Rho-киназа опосредует положительный эффект PKG на уровень PIP 2 в стволе мозга.

    Рисунок 3. Активатор

    Rho увеличивал уровень PIP 2 и устранял эффект ингибитора PKG. Оценка уровня PIP 2 в синаптосомах ствола мозга с помощью ELISA ( A ) и тандемной масс-спектрометрии ( B ). Обработка ткани ствола мозга активатором Rho II (производным CNF) (5 мкг / мл) в течение 15 мин при 37 ° C значительно увеличила содержание синаптосом PIP 2 . Купание ткани активатором Rho спасало ингибирующий эффект Rp-cGMPS (3 мкм) на уровне PIP 2 ( n = 6).

    Активатор

    Rho II (5 мкг / мл) при введении Rp-cGMPS в чашечку пресинаптического терминала Held устраняет замедляющее действие ингибитора PKG на эндоцитоз везикул (8,0 ± 0,5 с, n = 4) (рис. 4 А ). Активатор Rho II, будучи загруженным отдельно, не оказывал значительного влияния на скорость эндоцитоза (8,2 ± 0,4 с, n = 7), как и однократная нагрузка PIP 2 (Eguchi et al., 2012), что позволяет предположить, что эндогенный PIP 2 близок к уровню насыщения в нормальной пресинаптической терминальной мембране.Активатор Rho не влиял ни на экзоцитарную ΔC m , ни на I Ca (фиг. 4 A ). Эти результаты предполагают, что пресинаптическая Rho-киназа ускоряет эндоцитоз везикул, действуя ниже сигнального каскада NO / PKG.

    Фиг.4. Активатор

    Rho II обратил замедляющее действие ингибитора PKG на эндоцитоз везикул путем повышения уровня PIP 2 . A , Внутритерминальная нагрузка активатора Rho II (полученного из CNF) (5 мкг / мл) в окончание чашечки не оказывала влияния на эндоцитоз (зеленый след и столбики).Совместное использование активатора Rho II с Rp-cGMPS (3 мкм) обращало (синий) ингибирующий эффект Rp-cGMPS (красный) на эндоцитоз. Данные взяты из 6–10 кал. B , Anti-PIP 2 антитело (20 мкг / мл, красный след и столбцы), загруженные в пресинаптические окончания, значительно замедлили изменения эндоцитов C m , тогда как кипяченое антитело анти-PIP 2 (20 мкг / мл, черный) не оказали влияния. В присутствии антитела против PIP 2 активатор Rho II больше не спасал ингибирующий эффект Rp-cGMPS (синий).Данные взяты из 4–6 кал.

    Чтобы проверить, действительно ли спасительный эффект активатора Rho на скорость эндоцитоза опосредован эндогенной продукцией PIP 2 , мы загрузили антитело против PIP 2 в окончание чашечки. Это антитело, когда оно загружено отдельно, замедляло эндоцитоз везикул (19,4 ± 2,1 с, n = 5), тогда как кипяченое антитело не имело эффекта, что позволяет предположить, что антитело снижает доступный PIP 2 (фиг. 4 B ). В присутствии антитела против PIP 2 в пресинаптических окончаниях активатор Rho больше не спасает скорость эндоцитоза, замедленную Rp-cGMPS (18.5 ± 1,6 с, n = 4) (рис.4 B ).

    Обсуждение

    В настоящем исследовании ингибирование активности Rho-киназы с помощью Y27632 специфически уменьшало содержание PIP 2 в синаптосомной фракции ткани ствола мозга и замедляло динамику эндоцитоза везикул, регистрируемую с использованием измерений емкости в чашечках пресинаптических окончаний Held. Напротив, усиление активности Rho-киназы с помощью активатора Rho II увеличивало уровни синаптосомного PIP 2 и противодействовало замедляющему эффекту ингибитора PKG на эндоцитоз везикул.Когда эндоцитоз везикул замедляется, пополнение высвобождаемых везикул за счет рециркуляции замедляется. Это искажает точность синаптической передачи, особенно в ответ на длительные высокочастотные входы (Eguchi et al., 2012). В этом отношении Rho-киназа играет ключевую роль в молекулярном каскаде, обеспечивая гомеостатический контроль высокочастотной передачи информации через нейронные цепи. Этот каскад работает, когда постсинаптические рецепторы NMDA активируются глутаматом, высвобождаемым из пресинаптических окончаний, и ускоряют эндоцитоз за счет продукции PIP 2 зависимым от активности образом в соответствии с величиной экзоцитоза, тем самым связывая рециклинг везикул с активностью нейронов (Micheva et al. ., 2003; Eguchi et al., 2012). Ретроградная связь постсинаптических NMDA рецепторов с пресинаптическими PKG опосредуется NO, но связь PKG с PIP 2 в пресинаптических окончаниях остается неуловимой (Micheva et al., 2003; Eguchi et al., 2012). В этом исследовании мы показали, что Rho-киназа опосредует молекулярный каскад от PKG до PIP 2 . Хотя настоящее исследование проводилось при комнатной температуре (26–27 ° C), скорость эндоцитоза выше при физиологической температуре более чем в 1 раз.4 (Фернандес-Альфонсо и Райан, 2004 г .; Мичева и Смит, 2005 г .; Ренден и фон Герсдорф, 2007 г.). Аналогичным образом, при физиологической температуре активность различных киназ и рецепторов NMDA (Steinert et al., 2010), участвующих в этом ретроградном каскаде, выше. Таким образом, этот механизм экзоэндоцитарного связывания д. Действовать более эффективно для поддержания высокоточной высокочастотной синаптической передачи in vivo .

    PKG напрямую связывается с GTPase RhoA (Kato et al., 2012) и отрицательно контролирует активность Rho-киназы при сокращении гладких мышц сосудов (Sauzeau et al., 2000; Sandu et al., 2001; Kato et al., 2012) и формирование стрессовых волокон (Sawada et al., 2001). Напротив, PKG может положительно контролировать экспрессию RhoA (Sauzeau et al., 2003; Rolli-Derkinderen et al., 2005) и активность Rho-киназы, возможно, посредством фосфорилирования RhoGEF17 (Lutz et al., 2013). Последующий эффектор, Rho-киназа, также связывается и активирует PIP5K (Weernink et al., 2000, 2004; Yang et al., 2004), который продуцирует PIP 2 посредством фосфорилирования PIP. Таким образом, усиливающий эффект активатора RhoA на содержание PIP 2 в синаптосомах ствола мозга (рис.3), вероятно, опосредуется активацией PIP5K. Хотя Rho-киназа может также увеличивать доступность PIP для киназы PIP5 (Yamamoto et al., 2001), интратерминальная нагрузка PIP не устраняет замедляющий эффект ингибитора Rho-киназы на эндоцитоз везикул, в отличие от нагрузки PIP 2 (рис. 2 B ), предполагая, что PIP5K, вероятно, является основной мишенью Rho-киназы в нервном окончании. Проведенный нами масс-спектрометрический анализ фосфолипидов показал, что ингибитор Rho-киназы Y27632 специфически снижает содержание PIP 2 в синаптосомах ствола мозга с небольшим влиянием на содержание PIP (рис.1 C , D ). Эти результаты согласуются с сообщениями о том, что основной локус клеточного PIP находится в мембране клеток Гольджи (Wang et al., 2003) и что пул PIP в плазматической мембране мало способствует синтезу de novo PIP 2 ( Hammond et al., 2012).

    В заключение, мы выяснили новую физиологическую функцию Rho-киназы, которая положительно контролирует эндоцитоз синаптических везикул путем активации плазматической мембраны PIP 2 .Эта функция связана через ретроградный сигнальный каскад NO и PKG, который необходим для поддержания высокоточной синаптической передачи в ЦНС.

    Сноски

    • Эта работа была поддержана программой основных исследований в области эволюционной науки и технологий Японского агентства науки и технологий TT и грантом Министерства образования, культуры, спорта, науки и технологий Японии для молодежи. Ученые к KE Мы благодарим Стивена Д. Эйрда за редактирование этой рукописи и Майкла К.Рою за техническую помощь.

    • Авторы заявляют об отсутствии конкурирующих финансовых интересов.

    • Корреспонденция должна быть адресована доктору Захари Тауфик или доктору Томоюки Такахаши, Клеточная и молекулярная синаптическая функциональная единица, Окинавский институт науки и технологий, аспирантура, 1919-1 Танча, Онна-сон, Окинава 904-0495, Япония. zacharie.taoufiq {at} oist.jp или ttakahas {at} oist.jp

    Иммунный ответ на внеклеточные пузырьки из островков Лангерганса человека у пациентов с диабетом 1 типа | Эндокринология

    Аннотация

    Аутоиммунный ответ, характеризующий диабет 1 типа (СД1), не имеет четкой причины.Внеклеточные везикулы (EV) играют важную роль в запуске иммунного ответа в других контекстах. Здесь мы предлагаем модель, с помощью которой ЭВ, выделенные из островков человека, стимулируют провоспалительные иммунные ответы и приводят к активации мононуклеарных клеток периферической крови (PBMC). Мы показываем, что островковые ЭВ человека интернализуются моноцитами и В-клетками и приводят к увеличению экспрессии Т-хелперов 1, 2 и 17 цитокинов, а также к пролиферации Т- и В-клеток. Важно отметить, что мы демонстрируем активацию Т- и В-клеток памяти с помощью электромобилей выборочно в МКПК пациентов с СД1.Кроме того, EV островков человека индуцируют увеличение антител против декарбоксилазы глутаминовой кислоты 65 (GAD65) в PBMC T1D. Кроме того, предварительная обработка PBMC T1D ибрутинибом, ингибитором тирозинкиназы Bruton, ослабляет вызванную EV активацию B-клеток памяти и выработку антител GAD65. В совокупности наши результаты указывают на роль островковых ЭВ человека в опосредовании активации В- и Т-клеток и продукции аутоантител к GAD65.

    Диабет 1 типа (СД1) — хроническое аутоиммунное заболевание, связанное с избирательным разрушением инсулин-секретирующих β -клеток панкреатических островков Лангерганса (1, 2).Для него характерно развитие аутоантител, направленных против антигенов β -клеток поджелудочной железы (3). Клеточные и молекулярные события, участвующие в генерации аутореактивных иммунных клеток, были частично описаны, но конкретные события, запускающие этот процесс, до сих пор неизвестны.

    Было показано, что пациенты с СД1 проявляют иммунную дисрегуляцию и склонность к провоспалительному фенотипу (4, 5), о чем свидетельствует повышенная частота других аутоиммунных заболеваний у пациентов с СД1 (6, 7).Среди гипотез, предложенных для различных исходных событий, постоянно возникают стимулы окружающей среды, включая вирусные и бактериальные патогены. Доказательства первичного повреждения β -клеток в начале заболевания остаются немногочисленными, учитывая редкость патологических данных во время развития аутоиммунитета (8).

    В последнее время внеклеточные пузырьки (EV) привлекли большое внимание как важные медиаторы передачи сигналов клеток (9, 10). Они высвобождаются различными типами клеток во внеклеточную среду и содержат подмножество белков, липидов и нуклеиновых кислот, что делает их привлекательными биомаркерами тканеспецифических заболеваний (11-15).Недавние открытия предполагают, что ЭВ могут действовать как носители антигена иммуномодулирующих сигналов, что имеет важные эффекты при раке и аутоиммунных заболеваниях (16–23).

    В контексте T1D было показано, что экзосомы, полученные из клеток инсулиномы MIN6, стимулируют аутореактивные Т-клетки и В-клетки, которые накапливаются в поджелудочной железе мышей с преддиабетическим диабетом без ожирения (NOD) (24, 25). Кроме того, связанные с островками мезенхимальные стволовые клетки, подобные клеткам, выделяют экзосомы с иммуностимулирующими способностями, которые активируют аутореактивные лимфоциты у мышей NOD (26).Недавно мы (27) и другие (28) показали, что ЭВ, выделяемые островками человека, могут действовать как носители антигена, содержащие, в частности, аутоантигены диабета-кандидата, такие как декарбоксилаза глутаминовой кислоты 65 (GAD65) и переносчик цинка 8 (ZnT8). Однако о роли EV островков человека в презентации антигена и в модуляции иммунного ответа не сообщалось.

    Здесь мы стремились определить потенциал ЭВ, происходящих из островков человека, в модуляции Т- и В-клеточных ответов, что может дать представление о роли ЭВ в стимулировании аутоиммунных ответов.

    Материалы и методы

    Люди и образцы крови

    Информированное согласие было получено после объяснения характера и возможных последствий исследования и сбора образцов периферической крови (от 10 до 40 мл) у пациентов с СД1 (n = 12) и здоровых людей из контрольной группы (HCs) (n = 12). Такие параметры, как возраст, пол и индекс массы тела (ИМТ), существенно не различались между HCs и пациентами с T1D (Таблица 1). Мононуклеарные клетки периферической крови (PBMC) выделяли с использованием среды для разделения лимфоцитов (Wisent).PBMC культивировали в RPMI 1640 (Gibco) с добавлением 5% человеческой сыворотки (GemCell), 2 мМ глутамина (Wisent) и 1% пенициллина / стрептомицина (100 Ед / мл пенициллина, 100 мкг / мл стрептомицина; Wisent). Выделенные РВМС замораживали в фетальной бычьей сыворотке с 10% диметилсульфоксидом (ДМСО) и хранили в жидком азоте.

    Таблица 1. Характеристики доноров PBMC

    T1D (n = 12) и HC (n = 12)

    Характеристики доноров T1D PBMC (n = 12)
    .
    Характеристики донора HC PBMC (n = 12)
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Секс . Возраст, г . ИМТ, кг / м 2 .
    Женский 54 15,6 Мужской 51 22.6
    Мужской 60 23,8 Женский 43 23,3
    Мужской 23 23,7 Женский 917 917 917 917 917 917 917 917 917 917 9178 28,2 Женский 51 21,9
    Мужской 38 27,2 Мужской 23 23.5
    Мужской 32 23,8 Мужской 60 28,3
    Мужской 45 27,1 Женский 917 917 917 917 917 917 917 917 20,2 Мужской 35 24,7
    Женский 30 24,9 Мужской 41 32.1
    Мужской 54 40,6 Мужской 40 28,6
    Женский 36 31,2 Мужской 917 917 917 917 917 917 917 917 917 917 9178 14,6 Самка 28 23,7
    4 F / 8 M, среднее ± SEM 40,3 ± 3,3 25,1 ± 1,9 5 F / 7 M, среднее ± SEM 40.0 ± 3,2 25,1 ± 0,9
    Характеристики донора T1D PBMC (n = 12)
    .
    Характеристики донора HC PBMC (n = 12)
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Секс . Возраст, г . ИМТ, кг / м 2 .
    Женский 54 15,6 Мужской 51 22,6
    Мужской 60 23,8 Женский 4317 1 1 23,8 Женский 917 Женский 917 23,7 Женский 40 22,2
    Мужской 27 28,2 Женский 51 21.9
    Мужской 38 27,2 Мужской 23 23,5
    Мужской 32 23,8 Мужской 917 917 917 917 917 917 27,1 Женский 40 24,3
    Женский 37 20,2 Мужской 35 24,7
    Женский Женский 9 Мужской 41 32,1
    Мужской 54 40,6 Мужской 40 28,6
    Женский
    Мужской 47 14,6 Женский 28 23,7
    4 F / 8 M, среднее ± SEM 40,3 ± 3.3 25,1 ± 1,9 5 F / 7 M, среднее ± SEM 40,0 ± 3,2 25,1 ± 0,9
    Таблица 1.

    T1D (n = 12) и HC (n = 12) Донор PBMC Характеристики

    7
    T1D PBMC Характеристики донора (n = 12)
    .
    Характеристики донора HC PBMC (n = 12)
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Секс . Возраст, г . ИМТ, кг / м 2 .
    Женский 54 15,6 Мужской 51 22,6
    Мужской 60 23,8 60 23,8 Женский 917 1 2317 917 Женский 917 81 917 Женский 917 23,7 Женский 40 22.2
    Мужской 27 28,2 Женский 51 21,9
    Мужской 38 27,2 Мужской 917 917 917 23 917 917 23 9178 23,8 Мужской 60 28,3
    Мужской 45 27,1 Женский 40 24,3
    371781 3780 Женский 2 Мужской 35 24,7
    Женский 30 24,9 Мужской 41 32,1
    Мужской
    Женский 36 31,2 Мужской 25 26,4
    Мужской 47 14,6 Женский 28 .1781
    4 F / 8 M, среднее ± SEM 40,3 ± 3,3 25,1 ± 1,9 5 F / 7 M, среднее ± SEM 40,0 ± 3,2 25,1 ± 0,9
    7
    Характеристики донора T1D PBMC (n = 12)
    .
    Характеристики донора HC PBMC (n = 12)
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Секс . Возраст, г . ИМТ, кг / м 2 .
    Женский 54 15,6 Мужской 51 22,6
    Мужской 60 23,8 60 23,8 Женский 917 1 2317 917 Женский 917 81 917 Женский 917 23,7 Женский 40 22.2
    Мужской 27 28,2 Женский 51 21,9
    Мужской 38 27,2 Мужской 917 917 917 23 917 917 23 9178 23,8 Мужской 60 28,3
    Мужской 45 27,1 Женский 40 24,3
    371781 3780 Женский 2 Мужской 35 24,7
    Женский 30 24,9 Мужской 41 32,1
    Мужской
    Женский 36 31,2 Мужской 25 26,4
    Мужской 47 14,6 Женский 28 .1781
    4 F / 8 M, среднее ± SEM 40,3 ± 3,3 25,1 ± 1,9 5 F / 7 M, среднее ± SEM 40,0 ± 3,2 25,1 ± 0,9

    Выделение нейтрофилов человека

    Нейтрофилы человека были выделены из крови HC. Вкратце, кровь разбавляли 1: 1 в PBS (Wisent) и наслаивали на среду для разделения лимфоцитов (Wisent). После центрифугирования при 1200 90 269 g в течение 20 минут при комнатной температуре (RT) осадок, содержащий нейтрофилы и эритроциты, собирали и ресуспендировали в 6% декстране (Thermo Fisher) и оставляли при комнатной температуре для осаждения эритроцитов.Через 30 минут супернатант собирали и центрифугировали при 1500 об / мин в течение 5 минут при комнатной температуре. Затем оставшиеся эритроциты в осадке, богатом нейтрофилами, лизировали с помощью буфера для лизирования Pharm Lyse (BD Biosciences). Затем полученный осадок промывали и ресуспендировали в ледяном PBS. Жизнеспособность полученных нейтрофилов проверяли окрашиванием трипановым синим (Wisent Bioproducts). Нейтрофилы культивировали в RPMI 1640 (Gibco) с добавлением 5% человеческой сыворотки (GemCell), 2 мМ глутамина (Wisent) и 1% пенициллина / стрептомицина (100 Ед / мл пенициллина, 100 мкг / мл стрептомицина; Wisent).

    Изоляция и культивирование островков человека

    островков было извлечено от доноров мультиорганных человеческих организмов с мертвым мозгом (n = 10), у которых в анамнезе не было диабета или заболеваний поджелудочной железы любого типа (таблица 2). Извлечение поджелудочной железы проводилось во время восстановления нескольких органов для трансплантации и после получения согласия на исследование от ближайших родственников координаторами Transplant Québec. Выделение островков было выполнено в Лаборатории трансплантации островков человека в Медицинском центре Университета Макгилла в соответствии с ранее описанными протоколами (29–31).Вкратце, поджелудочные железы были загружены ферментами холодной коллагеназы (Clyzyme Collagenase HA; VitaCyte) и нейтральной протеазой (Clyzyme Thermolysin; VitaCyte). Поджелудочную железу диссоциировали при 37 ° C в рециркуляционной петле. Островки очищали от экзокринной ткани с градиентом плотности optiprep на клеточном процессоре COBE 2991 (Terumo BCT). В этих исследованиях использовались только островковые препараты с чистотой ≥80%, жизнеспособностью ≥90% и коэффициентом секреции инсулина, стимулированной глюкозой,> 1,0.

    Таблица 2.

    Характеристики донора поджелудочной железы человека и оценка подготовки островков (n = 10)

    Характеристики донора островков
    .
    Оценка острова
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Чистота,% . Жизнеспособность,% .
    Женский 65 23.9 80,0 92,3
    Мужской 48 30,5 93,5 96,8
    Женский 64 28,6 Мужской 32,4 85,0 98,0
    Мужской 41 23,9 87,5 95,5
    Мужской 53 29.3 80,7 92,0
    Мужской 44 22,8 96,5 98,0
    Мужской 57 25,2 57 25,2 36,7 80,0 98,0
    Мужской 55 30,7 93,5 95,2
    3 F / 7 M, среднее ± SEM 52.0 ± 2,3 28,4 ± 1,2 86,7 ± 1,8 95,1 ± 0,8
    Характеристики донора островков
    .
    Оценка острова
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Чистота,% . Жизнеспособность,% .
    Женский 65 23.9 80,0 92,3
    Мужской 48 30,5 93,5 96,8
    Женский 64 28,6 Мужской 32,4 85,0 98,0
    Мужской 41 23,9 87,5 95,5
    Мужской 53 29.3 80,7 92,0
    Мужской 44 22,8 96,5 98,0
    Мужской 57 25,2 57 25,2 36,7 80,0 98,0
    Мужской 55 30,7 93,5 95,2
    3 F / 7 M, среднее ± SEM 52.0 ± 2,3 28,4 ± 1,2 86,7 ± 1,8 95,1 ± 0,8
    Таблица 2.

    Характеристики донора поджелудочной железы человека и оценка подготовки островков (n = 10)

    Характеристики донора островков
    .
    Оценка острова
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Чистота,% . Жизнеспособность,% .
    Женский 65 23,9 80,0 92,3
    Мужской 48 30,5 93,5 30,5 93,5 9178 95,0
    Мужской 46 32,4 85.0 98,0
    Мужской 41 23,9 87,5 95,5
    Мужской 53 29,3 80,7 Мужское 96,5 98,0
    Мужской 57 25,2 90,0 90,0
    Женский 47 36.7 80,0 98,0
    Мужской 55 30,7 93,5 95,2
    3 F / 7 M, среднее значение ± стандартная ошибка среднего 52,017 ± 2,317 ± 2,3 ± 1,8 95,1 ± 0,8
    951 951 951
    Характеристики донора островков
    .
    Оценка острова
    .
    Пол . Возраст, г . ИМТ, кг / м 2 . Чистота,% . Жизнеспособность,% .
    Женский 65 23,9 80,0 92,3
    Мужской 48 30,5 93,5 30,5 93,5 9178 .0 95,0
    Мужской 46 32,4 85,0 98,0
    Мужской 41 23,9 87,5 23,9 87,5 80,7 92,0
    Мужской 44 22,8 96,5 98,0
    Мужской 57 25.2 90,0 90,0
    Женский 47 36,7 80,0 98,0
    Мужской 55 30,7 M31780 30,7 M3 , среднее значение ± стандартная ошибка среднего 52,0 ± 2,3 28,4 ± 1,2 86,7 ± 1,8 95,1 ± 0,8

    Изолированные островки высевали из расчета 600 островковых эквивалентов на миллилитр и культивировали в течение 24 часов в лабораториях медицинских исследований Коннаута 1066 (Mediatech) с добавкой 10 Ед / мл гепарина (Sandoz), 2.5% сывороточный альбумин человека (CSL Behring) и 10 мкг / мл ципрофлоксацина (Sandoz). Кондиционированную среду собирали из препаратов островков после 24 часов культивирования. Контроли (, т.е. , некондиционная среда с добавками) инкубировали в течение 24 часов в тех же условиях.

    EV Очистка и маркировка

    ЭВ очищали последовательным центрифугированием. Мы вращали 50 мл образца среды, кондиционированной островками, при 1200 г в течение 15 минут для осаждения клеток и остатков.Супернатант переносили в ультрацентрифужные пробирки и центрифугировали при 150 000 g в течение 2 часов. Гранулы промывали один раз и ресуспендировали в конечном объеме 500 мкл PBS. Образцы EV были заморожены при -80 ° C до дальнейшего использования. EV оттаивали при 37 ° C, метили 1 мкМ Cell Tracker (CT) Deep Red (Thermo Fisher) и инкубировали в течение 30 минут при 37 ° C. Затем EV промывали 150 000 г в течение 18 часов, осаждали, ресуспендировали в определенном объеме культуральной среды и подвергали воздействию эффекторных клеток.Если не указано иное, в каждом эксперименте использовали 5 мкл EV (или контрольных EV, обработанных и окрашенных параллельно из некондиционной среды).

    Анализ проточной цитометрии и стратегия стробирования

    PBMC (от 200000 до 250 000) высевали в 96-луночные планшеты и совместно культивировали с СТ-меченными островковыми EV или контрольными EV в течение от 0 часов до 7 дней и анализировали проточной цитометрией. Все образцы окрашивали красителем жизнеспособности, Fixable Viability Dye eFluor 506 или 780 (eBioscience), для облегчения гейтинга живых клеток перед окрашиванием поверхности клеток и внутриклеточным окрашиванием.Дублеты исключались с помощью высоты прямого рассеяния относительно области прямого рассеяния и, следовательно, высоты бокового рассеяния относительно области бокового рассеяния. Флуоресцентные контроли минус один использовали для стробирования для анализов внутриклеточных цитокинов. Все данные были получены на цитометре LSRFortessa и проанализированы с помощью программного обеспечения FlowJo (Tree Star, Inc.).

    EV анализы интернализации

    PBMC (250 000) высевали в 96-луночные планшеты с плоским дном и культивировали с CT-меченными EV (или CT-меченными контрольными EV) в течение от 0 до 48 часов.PBMC собирали и окрашивали на маркеры клеточной поверхности с использованием следующей панели антител: анти-CD4 Alexa Fluor 405 [eBioscience (32)], анти-CD8 PE-Cy7 [eBioscience (33)], анти-CD11c PE [Biolegend (34) ], анти-CD14 BV650 [Biolegend (35)], анти-CD19 Alexa Fluor 488 [eBioscience (36)] и анти-CD56 PerCP [eBioscience (37)]. Нейтрофилы (500000) также совместно культивировали с CT-меченными EV (или CT-меченными контрольными EV), собирали через 6 часов и окрашивали анти-CD15 BV605 [Biolegend (38)].

    Визуализирующая проточная цитометрия

    PBMC (250 000) помещали в 96-луночные планшеты с плоским дном и культивировали в течение 24 часов с CT-меченными EV (или CT-меченными контрольными EV).Клетки собирали и окрашивали 4 ‘, 6-диамидино-2-фенилиндолом (DAPI) (Thermo Fisher) и анти-CD14 PerCP [eBioscience (39)]. Изображения были получены на проточном цитометре Amnis ImageStream Mark II Imaging с увеличением × 40 (EMD Millipore). Данные были получены и проанализированы с помощью программ Amnis INSPIRE и Amnis IDEAS соответственно.

    Окрашивание внутриклеточных цитокинов

    Для определения экспрессии цитокинов в подмножествах PBMC, PBMC (250 000) и EV (или контрольные EV) культивировали совместно в течение 24 часов.Чтобы определить экспрессию цитокинов в моноцитах, PBMC рестимулировали липополисахаридом (LPS) (Sigma-Aldrich; 1 мкг / мл), а транспорт белка блокировали брефельдином A (eBioscience) в течение последних 5 часов культивирования. Клетки окрашивали на маркер клеточной поверхности PerCP против CD14 [eBioscience (39)]. Перед внутриклеточным окрашиванием клетки фиксировали и повышали проницаемость с помощью набора буферов для фиксации и пермеабилизации IC (eBioscience) в соответствии с инструкциями производителя. Затем клетки окрашивали на внутриклеточные маркеры следующими антителами: анти-TNF- α FITC [eBioscience (40)], анти-IL-10 PE [eBioscience (41)], анти-IL-6 APC [eBioscience (42). )] и анти-IL-1 β PE [eBioscience (43)].Супернатанты этих культур использовали для иммуноферментных анализов цитокинов (ELISA). Чтобы определить экспрессию цитокинов в Т-клетках, PBMC рестимулировали коктейлем для стимуляции клеток (включая ингибитор транспорта белка) (eBioscience) в течение последних 5 часов культивирования и окрашивали на маркеры клеточной поверхности анти-CD4 Alexa Fluor 405 [eBioscience (32)] и анти-CD8 PE-Cy7 [eBioscience (33)]. PBMC окрашивали внутриклеточно анти-TNF- α Alexa Fluor 488 [Thermo Fisher (44)], анти-IL-17 PerCP eFluor 710 [eBioscience (45)], анти-интерфероном- γ (IFN- γ ) PE [eBioscience (46)] и анти-IL-4 APC [eBioscience (47)] после фиксации и пермеабилизации.

    IL-6, TNF-

    α, и IL-1 β ELISA ИФА

    человеческого IL-6, TNF- α, и IL-1 β проводили в соответствии с инструкциями производителя (IL-6, TNF- α, и IL-1 β без покрытия, наборы ELISA; Thermo Фишер). Супернатанты культур от LPS-стимулированных EV-подвергнутых воздействию PBMC обрабатывали в двух экземплярах. Для обнаружения IL-6 супернатанты разбавляли 1: 400 в PBS. Для ELISA TNF- α и IL-1 β супернатанты разбавляли 1:40.Оптическую плотность определяли с помощью считывающего устройства для микропланшетов (Synergy h5, Biotek), установленного на 450 нм, с длиной волны коррекции, установленной на 540 нм.

    Анализы пролиферации сукцинимидилового эфира карбоксифлуоресцеина

    Для анализов пролиферации РВМС (200000) метили флуорогенным красителем карбоксифлуоресцеинсукцинимидиловым эфиром (CFSE) (Thermo Fisher) в конечной концентрации 5 мкМ и совместно культивировали в 96-луночных планшетах для культивирования тканей с плоским дном. PBMC примировали в день 0 островковыми EV (или контрольными EV) и рестимулировали EV в присутствии фитогемагглютинина (PHA) (Sigma-Aldrich; 5 мкг / мл) на 2 день.Клетки собирали на 7 день; Пролиферацию Т- и В-клеток оценивали разбавлением красителя CFSE. Использовали антитела против CD4 Alexa Fluor 405 [eBioscience (32)] и против CD19 PerCP [eBioscience (48)] на поверхности клеток.

    Анализы активации Т- и В-клеток памяти

    Двести тысяч PBMC из группы T1D или HC были примированы EV (или контрольными EV). Для оценки активации Т-клеток на 2-й день PBMC стимулировали PHA (5 мкг / мл) и второй дозой EV (или контрольных EV).На 7 день клетки собирали и окрашивали на анти-CD4 Alexa Fluor 405 [eBioscience (32)], анти-CD45RA PE-Cy7 [eBioscience (49)], анти-CD45RO PE [eBioscience (50)], анти-CD45RO PE [eBioscience (50)], анти-CD4-CD4 Alexa Fluor 405 [eBioscience (32)]. -CD69 BV650 [BD Biosciences (51)], анти-CD62L APC eFluor 780 [eBioscience (52)] и анти-CCR7 APC [eBioscience (53)]. Для оценки активации В-клеток на 2 день стимулировали PBMC комбинацией человеческого ИЛ-2 (10 нг / мл; R&D Systems) и резиквимода (R848) (1 мкг / мл; R&D Systems) и второй дозой ЭВ. (или контрольный EV) с ингибитором тирозинкиназы Bruton (BTK) ибрутинибом (100 нМ; Cayman) или носителем (DMSO).На 7-й день клетки собирали и окрашивали на анти-CD19 PerCP [eBioscience (48)], анти-CD27 PE-Cy7 [eBioscience (54)], анти-CD69 BV650 [BD Bioscience (51)] и анти-CD27 PE-Cy7 [eBioscience (48)]. -IgD PE [Электронная наука (55)]. Супернатанты собирали из культур В-клеток, стимулированных IL-2 / R848, и использовали для GAD65 ELISA.

    GAD65 антитело ELISA

    ELISA на человеческое антитело GAD65 (IgG) проводили в соответствии с протоколом, предложенным производителем, с небольшими модификациями (Cusabio).Вкратце, чистый культуральный супернатант из сокультив EV PBMC T1D и HC, стимулированных IL-2 / R848, анализировали в двух экземплярах для определения титров антител GAD65. Оптическую плотность определяли с помощью считывающего устройства для микропланшетов (Synergy h5, Biotek), установленного на 450 нм, с длиной волны коррекции, установленной на 540 нм.

    Статистика

    Данные выражены как средние значения ± SEM. Данные анализировали с помощью двустороннего критерия Стьюдента t или одностороннего дисперсионного анализа с использованием апостериорного анализа Бонферрони для множественных сравнений.Статистический анализ выполняли в Prism 7 (GraphPad software Inc.). P <0,05 считалось статистически значимым.

    Одобрение исследования

    Исследование было одобрено Советом по этике исследований Медицинского центра Университета Макгилла (15-582-MUHC) и проводилось в соответствии с принципами, изложенными в Хельсинкской декларации. Письменное информированное согласие было получено от участников до включения в исследование. Все образцы пациентов были закодированы и идентифицированы по номерам.

    Результаты

    ЭВ островков человека интернализуются PBMC

    Чтобы исследовать иммунологический потенциал островковых ЭВ человека, мы выделили ЭВ из супернатантов культуры островков человека и сокультивировали эти ЭВ с РВМС из УВ. ЭВ были помечены флуоресцентным мембранным красителем СТ. Некондиционированную среду использовали в качестве отрицательного контроля и параллельно окрашивали. При совместном культивировании с EV, PBMC превратились в EV + , как измерено клетками CT + .Этот ответ частично подавлялся при 4 ° C, что свидетельствует об энергозависимом процессе (рис. 1A и 1B). Наблюдалось зависящее от времени увеличение PBMC EV + , которые насыщались через 24 часа (рис. 1C). Чтобы определить, какие конкретные типы клеток в препаратах PBMC реагируют на EV, CT-меченные EV инкубировали с PBMC (24 часа) или нейтрофилами (6 часов) и анализировали с помощью специфических маркеров на Т-клетки (CD4 + / CD8 + ) , моноциты (CD14 + ), В-клетки (CD19 + ), естественные киллеры (NK) клетки (CD56 + ) и нейтрофилы (CD15 + ).ЭВ эффективно интернализовались моноцитами CD14 + и в меньшей степени В-клетками CD19 + , но интернализация ЭВ Т-клетками не отличалась от отрицательного контроля, несмотря на то, что это наиболее распространенный тип клеток (рис. 1D и 1E). Точно так же не было обнаружено захвата NK-клетками или нейтрофилами. Взятые вместе, эти результаты предполагают, что HC PBMCs реагируют на EV посредством поглощения специфическими антигенпредставляющими клетками (APC).

    Рисунок 1.

    EV интернализуются PBMC, особенно моноцитами и B-клетками.(A, B) HC PBMC инкубировали с CT-меченными (1 мкМ) EV в течение 24 часов при 4 ° C или 37 ° C, и интернализацию EV измеряли с помощью проточной цитометрии. Типичные точечные диаграммы показывают стратегию стробирования, и указан процент клеток, интернализовавших CT-меченые EV. В качестве отрицательного контроля ЭВ из некондиционной среды метили и загружали в эффекторные клетки параллельно. (C) PBMC инкубировали с CT-меченными EV (или контрольными EV) в течение 0, 1, 3, 6, 12, 24 и 48 часов, и интернализацию EV измеряли с помощью проточной цитометрии.(D, E) PBMC или нейтрофилы инкубировали с CT-меченными EV (или контрольными EV). Маркеры клеточной поверхности для Т-клеток (CD4 + и CD8 + ), В-клеток (CD19 + ), моноцитов (CD14 + ), NK-клеток (CD56 + ) и нейтрофилов (CD15 + ) и интернализации EV (CT Deep Red +) анализировали с помощью проточной цитометрии. Показаны характерные точечные графики. Данные представляют собой среднее значение ± стандартная ошибка среднего. Размер выборки для каждого эксперимента представляет не менее четырех доноров HC PBMC в трех технических повторностях с EV, по крайней мере, от трех различных доноров островков.* P <0,05. SSC, боковой разброс.

    Рисунок 1.

    EV интернализуются PBMC, в частности моноцитами и B-клетками. (A, B) HC PBMC инкубировали с CT-меченными (1 мкМ) EV в течение 24 часов при 4 ° C или 37 ° C, и интернализацию EV измеряли с помощью проточной цитометрии. Типичные точечные диаграммы показывают стратегию стробирования, и указан процент клеток, интернализовавших CT-меченые EV. В качестве отрицательного контроля ЭВ из некондиционной среды метили и загружали в эффекторные клетки параллельно.(C) PBMC инкубировали с CT-меченными EV (или контрольными EV) в течение 0, 1, 3, 6, 12, 24 и 48 часов, и интернализацию EV измеряли с помощью проточной цитометрии. (D, E) PBMC или нейтрофилы инкубировали с CT-меченными EV (или контрольными EV). Маркеры клеточной поверхности для Т-клеток (CD4 + и CD8 + ), В-клеток (CD19 + ), моноцитов (CD14 + ), NK-клеток (CD56 + ) и нейтрофилов (CD15 + ) и интернализации EV (CT Deep Red +) анализировали с помощью проточной цитометрии.Показаны характерные точечные графики. Данные представляют собой среднее значение ± стандартная ошибка среднего. Размер выборки для каждого эксперимента представляет не менее четырех доноров HC PBMC в трех технических повторностях с EV, по крайней мере, от трех различных доноров островков. * P <0,05. SSC, боковой разброс.

    Интернализация ЭВ моноцитами CD14

    + приводит к экспрессии провоспалительных цитокинов

    Интернализация EV моноцитами CD14 + была подтверждена с помощью проточной цитометрии с визуализацией.Мы наблюдали аналогичный процент клеток CD14 + , которые были EV + при совместном культивировании, как и при традиционной проточной цитометрии, что подтверждает наши наблюдения (рис. 2A и 2B). Затем оценивали влияние как времени, так и дозировки на поглощение ЭВ моноцитами. Со временем наблюдалось увеличение количества EV + CD14 + клеток, следуя схеме, аналогичной общему захвату PBMC (фиг. 2C). Однако при увеличении дозировки ЭВ значительного увеличения поглощения ЭВ между дозами 5, 10 и 20 мкл не наблюдалось (рис.2D). Для целей следующих экспериментов была выбрана более низкая доза ЭВ (5 мкл), поскольку было установлено, что это количество может оказывать определяемый иммунологический эффект. Чтобы проверить способность EV активировать клетки CD14 + , было проведено внутриклеточное окрашивание цитокинов. Экспрессия цитокинов IL-6, TNF- α, и IL-1 β была значительно увеличена в клетках CD14 + после воздействия EV по сравнению с контролем (фиг. 2E и 2F). Не было обнаружено увеличения экспрессии IL-10 через 24 часа культивирования.Кроме того, было обнаружено увеличение секретируемого IL-6, TNF- α, и IL-1 β (рис. 2G – 2I). Эти результаты предполагают, что EV из первичных островков эффективно интернализуются APC, что приводит к их активации.

    Рисунок 2.

    Моноциты CD14 активируются в ответ на EV. (A, B) CT-меченные островковые EV (или контрольные EV) инкубировали с HC PBMC в течение 24 часов и анализировали с помощью проточной цитометрии с визуализацией на CD14 + EV + клеток.(C) PBMC инкубировали с CT-меченными EV (или контрольными EV) в течение 0, 1, 3, 6, 12, 24 и 48 часов, и интернализацию EV клетками CD14 + измеряли с помощью проточной цитометрии. (D) PBMC инкубировали с 0, 5, 10 или 20 мкл островковых EV, и поглощение моноцитами CD14 + измеряли с помощью проточной цитометрии. (E, F) HC PBMC инкубировали с EV (или контрольными EV) в течение 24 часов; в течение последних 5 часов культивирования PBMC рестимулировали LPS (1 мкг / мл), а транспорт белка блокировали брефельдином A.Клетки окрашивали на CD14 клеточной поверхности с последующим внутриклеточным окрашиванием на IL-6, IL-10, TNF- α, и IL-1 β . (G – I) культуральные супернатанты из PBMC собирали и измеряли секрецию (G) IL-6, (H) TNF- α и (I) IL-1 β с помощью ELISA. Данные представляют собой среднее ± SEM экспериментов, проведенных в трех технических повторностях, по крайней мере, с четырьмя донорами HC PBMC и тремя различными островками EV. * P <0,05. БФ, светлое поле.

    Рисунок 2.

    Моноциты CD14 активируются в ответ на ЭВ. (A, B) CT-меченные островковые EV (или контрольные EV) инкубировали с HC PBMC в течение 24 часов и анализировали с помощью проточной цитометрии с визуализацией на CD14 + EV + клеток. (C) PBMC инкубировали с CT-меченными EV (или контрольными EV) в течение 0, 1, 3, 6, 12, 24 и 48 часов, и интернализацию EV клетками CD14 + измеряли с помощью проточной цитометрии. (D) PBMC инкубировали с 0, 5, 10 или 20 мкл островковых EV, и поглощение моноцитами CD14 + измеряли с помощью проточной цитометрии.(E, F) HC PBMC инкубировали с EV (или контрольными EV) в течение 24 часов; в течение последних 5 часов культивирования PBMC рестимулировали LPS (1 мкг / мл), и транспорт белка блокировали брефельдином A. Клетки окрашивали на CD14 на клеточной поверхности с последующим внутриклеточным окрашиванием на IL-6, IL-10, TNF. — α, и ИЛ-1 β . (G – I) культуральные супернатанты из PBMC собирали и измеряли секрецию (G) IL-6, (H) TNF- α и (I) IL-1 β с помощью ELISA. Данные представляют собой среднее ± SEM экспериментов, проведенных в трех технических повторностях, по крайней мере, с четырьмя донорами HC PBMC и тремя различными островками EV.* P <0,05. БФ, светлое поле.

    ЭВ островков человека запускают T

    H 1, T H 2 и T H 17 иммунитет, пролиферацию и активацию

    Затем мы оценили, активировались ли Т- и В-клетки в ответ на ЭВ. Наблюдалось значительное увеличение IFN-γ , IL-4 и IL-17 в Т-клетках CD4 + в ответ на ЭВ, что соответствовало Т-хелперу (T H ) 1, T H 2 , T H 17 активация (рис.3A и 3B).

    Рисунок 3.

    ЭВ островков человека запускают провоспалительные реакции в Т-клетках посредством продукции цитокинов. (A – D) HC PBMC сокультивировали с 5 мкл EV (или контрольными EV) в течение 24 часов. В течение последних 5 часов культивирования клетки рестимулировали коктейлем клеточной стимуляции плюс ингибитор транспорта белка, а затем окрашивали на CD4 и CD8 клеточной поверхности, а также внутриклеточный IFN-, γ , IL-4, IL-17 и TNF-. α . Данные являются репрезентативными для среднего значения ± стандартная ошибка среднего для трех лунок и репрезентативны для экспериментов с по меньшей мере четырьмя донорами HC PBMC с тремя островковыми EV в трех технических повторностях.* P <0,05.

    Рисунок 3.

    ЭВ островков человека запускают провоспалительные реакции в Т-клетках посредством продукции цитокинов. (A – D) HC PBMC сокультивировали с 5 мкл EV (или контрольными EV) в течение 24 часов. В течение последних 5 часов культивирования клетки рестимулировали коктейлем клеточной стимуляции плюс ингибитор транспорта белка, а затем окрашивали на CD4 и CD8 клеточной поверхности, а также внутриклеточный IFN-, γ , IL-4, IL-17 и TNF-. α . Данные являются репрезентативными для среднего значения ± стандартная ошибка среднего для трех лунок и репрезентативны для экспериментов с по меньшей мере четырьмя донорами HC PBMC с тремя островковыми EV в трех технических повторностях.* P <0,05.

    Кроме того, наблюдалось увеличение TNF- α в клетках CD4 + и CD8 + в ответ на EV (рис. 3C и 3D).

    Затем была исследована активация PBMC в ответ на EV в PBMC HC и T1D. Воздействие ЭВ увеличивало пролиферацию общих лимфоцитов и CD4 + Т-клеток примерно в два раза как при HC, так и при T1D после стимуляции PHA, что измеряется процентным содержанием клеток CFSE low (рис.4A и 4B). Обработка EV увеличивала пролиферацию В-клеток CD19 + в четыре раза в HC, а затем увеличивалась до восьми раз в PBMC T1D. При воздействии ЭВ увеличение средней интенсивности флуоресценции (MFI) CD69 наблюдалось как в клетках CD4 + , так и в клетках CD19 + как при HC, так и при T1D с одинаковой величиной, что свидетельствует о врожденной активации PBMC под действием EV (рис. 4C и 4D). ). В совокупности эти результаты показывают, что ЭВ содержат врожденный стимул, который приводит к активации Т- и В-клеток, экспрессии провоспалительных цитокинов и пролиферации лимфоцитов.

    Рисунок 4.

    Воздействие ЭВ островков человека приводит к пролиферации и активации Т- и В-клеток. (A, B) PBMC HC или T1D окрашивали CFSE и праймировали EV (или контрольными EV) в день 0 с последующей второй дозой EV на 2 день и PHA (5 мкг / мл). Пролиферацию клеток CD4 + и CD19 + измеряли разбавлением красителя CFSE на 7-й день. Числа, отображаемые над границами, показывают процент пролиферировавших Т- или В-клеток (CFSE low клеток).(C) PBMC HC или T1D были примированы EV (или контрольными EV) в день 0, с последующей второй дозой EV на 2 день и PHA (5 мкг / мл). Клетки собирали на 7 день и окрашивали на CD4 и CD69. (D) PBMC HC или T1D были примированы EV (или контрольными EV) в день 0 с последующей второй дозой EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл). Клетки собирали на 7 день и окрашивали на CD19 и CD69. Данные являются репрезентативными для среднего значения ± SEM для трех лунок и репрезентативны для экспериментов с по меньшей мере 7 HC или T1D-донорами PBMC и тремя островковыми EV в трех технических повторностях.* P <0,05.

    Рисунок 4.

    Воздействие ЭВ островков человека приводит к пролиферации и активации Т- и В-клеток. (A, B) PBMC HC или T1D окрашивали CFSE и праймировали EV (или контрольными EV) в день 0 с последующей второй дозой EV на 2 день и PHA (5 мкг / мл). Пролиферацию клеток CD4 + и CD19 + измеряли разбавлением красителя CFSE на 7-й день. Числа, отображаемые над границами, показывают процент пролиферировавших Т- или В-клеток (CFSE low клеток).(C) PBMC HC или T1D были примированы EV (или контрольными EV) в день 0, с последующей второй дозой EV на 2 день и PHA (5 мкг / мл). Клетки собирали на 7 день и окрашивали на CD4 и CD69. (D) PBMC HC или T1D были примированы EV (или контрольными EV) в день 0 с последующей второй дозой EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл). Клетки собирали на 7 день и окрашивали на CD19 и CD69. Данные являются репрезентативными для среднего значения ± SEM для трех лунок и репрезентативны для экспериментов с по меньшей мере 7 HC или T1D-донорами PBMC и тремя островковыми EV в трех технических повторностях.* P <0,05.

    ЭВ островков человека вызывают дифференциальную активацию Т- и В-клеток памяти и выработку антител GAD65 при T1D по сравнению с HC

    Для оценки активации Т-клеток памяти PBMC от HC или T1D были примированы EV в течение 2 дней с последующим вторым воздействием EV и стимуляцией PHA. На 7 день клетки собирали и окрашивали маркерами клеточной поверхности CD4, CD45RA, CD45RO, CD62L, CCR7 и маркером активации CD69 для оценки активации Т-клеток памяти в ответ на EV.PHA-стимулированная активация Т-клеток памяти при HC и T1D имела сходные значения. Однако заметное увеличение MFI CD69 в Т-клетках памяти после воздействия ЭВ было обнаружено, в частности, в PBMC T1D, чего мы не наблюдали в HC (рис. 5A и 5B).

    Рисунок 5.

    ЭВ островков человека запускают дифференциальную активацию Т- и В-клеток памяти и выработку антител к GAD65 у HCs и пациентов с T1D. (A, B) PBMC от HC или T1D были примированы EV (или контрольными EV) в день 0, с последующим вторым стимулом EV в день 2 и обработкой PHA (5 мкг / мл).Клетки собирали на 7 день и окрашивали на CD4, CD45RO, CD45RA, CCR7, CD62L и CD69 на клеточной поверхности. Уровни CD69 MFI измеряли как маркер активации в Т-клетках памяти (CD4 + CD45RO + CD45RA CCR7 CD62L ). (C, D) PBMC от HC или T1D были примированы EV (или контрольными EV) в день 0 с последующим вторым стимулом с EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл). Клетки собирали на 7 день и окрашивали на маркеры активации В-клеток памяти (CD69 MFI CD19 + CD27 + IgD ).(E) Были собраны культуральные супернатанты из вышеупомянутых PBMC, обработанных IL-2 / R848, из T1D и HC, и уровни антител GAD65 были измерены с помощью ELISA. Данные являются репрезентативными для среднего ± SEM по крайней мере семи доноров T1D или HC PBMC, подвергшихся воздействию EV от двух разных доноров островков в трех технических повторностях. * P <0,05.

    Рисунок 5.

    ЭВ островков человека запускают дифференциальную активацию Т- и В-клеток памяти и выработку антител к GAD65 у HCs и пациентов с T1D. (A, B) PBMC от HC или T1D были примированы EV (или контрольными EV) в день 0, с последующим вторым стимулом EV в день 2 и обработкой PHA (5 мкг / мл).Клетки собирали на 7 день и окрашивали на CD4, CD45RO, CD45RA, CCR7, CD62L и CD69 на клеточной поверхности. Уровни CD69 MFI измеряли как маркер активации в Т-клетках памяти (CD4 + CD45RO + CD45RA CCR7 CD62L ). (C, D) PBMC от HC или T1D были примированы EV (или контрольными EV) в день 0 с последующим вторым стимулом с EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл). Клетки собирали на 7 день и окрашивали на маркеры активации В-клеток памяти (CD69 MFI CD19 + CD27 + IgD ).(E) Были собраны культуральные супернатанты из вышеупомянутых PBMC, обработанных IL-2 / R848, из T1D и HC, и уровни антител GAD65 были измерены с помощью ELISA. Данные являются репрезентативными для среднего ± SEM по крайней мере семи доноров T1D или HC PBMC, подвергшихся воздействию EV от двух разных доноров островков в трех технических повторностях. * P <0,05.

    Чтобы исследовать ответ В-клеток памяти на EV, PBMC были примированы EV с последующим вторым воздействием EV на 2 день в дополнение к IL-2 и R848. На 7 день определяли CD69 MFI CD19 + CD27 + IgD В-клеток памяти.Подобно наблюдениям за фенотипом Т-клеток памяти, активация В-клеток памяти была повышена у пациентов с СД1 после воздействия ЭВ, что не было обнаружено в HC (рис. 5C и 5D).

    Для дальнейшей оценки специфичности этого ответа на островковые антигены титры аутоантител GAD65 измеряли в супернатантах культуры, стимулированных IL-2 / R848 и EV, с помощью ELISA-анализа антител IgG к GAD65. Уровни антител GAD65 были повышены примерно в два раза в супернатантах культур от T1D после воздействия IL-2 / R848 без EV, что свидетельствует об активации ответа памяти при неспецифической стимуляции (рис.5E). Воздействие EV дополнительно индуцировало продукцию антител GAD65 в 1,5 раза селективно в PBMC T1D.

    EV-индуцированная активация может быть подавлена ​​

    in vitro путем предварительной обработки ингибитором BTK ибрутинибом

    Затем мы попытались определить, может ли блокирование передачи сигналов рецептора B-клеток уменьшать активацию провоспалительной памяти для EVs. Предварительная обработка ибрутинибом заметно ослабила активацию В-клеток памяти в ответ на ЭВ до уровней, аналогичных уровням необлученных РВМС (рис.6А). Кроме того, предварительная обработка ибрутинибом значительно снизила титры антител GAD65 в супернатантах культур до уровня, аналогичного контрольным значениям (фиг. 6B). Процент CD19 + B-клеток и процент CD19 + CD27 + IgD B-клеток памяти были значительно снижены после лечения ибрутинибом и не оказали никакого влияния на жизнеспособность клеток (56). Взятые вместе, эти данные показывают, что предварительная обработка ибрутинибом подавляет как опосредованную EV продукцию антитела GAD65, так и активацию В-клеток памяти.

    Рисунок 6.

    Предварительная обработка ибрутинибом подавляет EV-индуцированную активацию В-клеток памяти и выработку антител к GAD65. (A) PBMC от T1D были примированы EV (или контрольными EV) с последующим вторым стимулом EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл), а также ибрутинибом ( 100 нМ) или автомобильный ДМСО. Клетки собирали на 7 день и окрашивали на маркеры активации В-клеток памяти (CD69 MFI CD19 + CD27 + IgD ).(B) Культурные супернатанты PBMC T1D собирали, и уровни антитела GAD65 измеряли с помощью ELISA. Данные представляют собой среднее значение ± SEM для дублированных лунок и являются репрезентативными для экспериментов с пятью донорами T1D PBMC, совместно культивированными с EV, выделенными от двух доноров островков. * P <0,05.

    Рисунок 6.

    Предварительная обработка ибрутинибом подавляет вызванную EV активацию В-клеток памяти и выработку антител GAD65. (A) PBMC от T1D были примированы EV (или контрольными EV) с последующим вторым стимулом EV на 2 день и обработкой IL-2 (10 нг / мл) и R848 (1 мкг / мл), а также ибрутинибом ( 100 нМ) или автомобильный ДМСО.Клетки собирали на 7 день и окрашивали на маркеры активации В-клеток памяти (CD69 MFI CD19 + CD27 + IgD ). (B) Культурные супернатанты PBMC T1D собирали, и уровни антитела GAD65 измеряли с помощью ELISA. Данные представляют собой среднее значение ± SEM для дублированных лунок и являются репрезентативными для экспериментов с пятью донорами T1D PBMC, совместно культивированными с EV, выделенными от двух доноров островков. * P <0,05.

    Обсуждение

    Хотя EV были впервые обнаружены более 50 лет назад, недавние данные свидетельствуют о том, что они могут играть важную роль в межклеточной коммуникации и передаче сигналов и иметь потенциальное отношение к множественным патологическим состояниям (57–60).Было показано, что EV содержат уникальные белки, РНК, miRNA, а также важные антигены и иммуномодулирующие сигналы (10, 61–65). EV, высвобождаемые различными типами клеток, связываются с иммунными клетками и могут стимулировать (66–71) или подавлять (72–76) иммунные ответы в различных контекстах. Мы и другие недавно документально подтвердили, что островки человека выделяют ЭМ, содержащие известные аутоантигены T1D (27, 28). Чтобы понять роль EV в модулировании иммунного ответа, мы решили изучить влияние этих EV на первичные PBMC человека и различались ли эти эффекты между группами HC и T1D.Мы предоставили доказательства провоспалительного иммуногенного потенциала везикул человека, происходящих из островков.

    ЭВ островков человека интернализуются моноцитами и В-клетками; интернализация зависела как от времени, так и от дозы, что подтверждает чувствительность анализа для выявления различий во взаимодействиях EV с клетками-мишенями. Поглощение EV из других источников этими типами клеток было продемонстрировано другими группами (9, 77–80) и является интуитивным открытием, поскольку как моноциты, так и B-клетки действуют во врожденном иммунном ответе как APC при воздействии антигена.Поглощение EV частично ингибировалось при 4 ° C, что указывает на энергозависимый процесс, а не пассивное поглощение мембраной. Кроме того, мы наблюдали активацию моноцитов CD14 + через увеличение провоспалительных цитокинов (TNF- α , IL-6 и IL-1 β ) при воздействии ЭВ. Было показано, что эти три высоко провоспалительных цитокина проявляют цитотоксическое действие в отношении островков поджелудочной железы (81–83). Предыдущие исследования показали, что вредное действие моноцитов на β -клеток может быть частично опосредовано продуцированием TNF- α , хотя механизм остается не определенным (84).Кроме того, IL-6 является главным регулятором воспалительных реакций острой фазы и играет роль в возникновении хронического воспаления, особенно в случае T1D (85, 86). Интересно, что никаких изменений в IL-10 не было обнаружено при воздействии EV, что согласуется с иммуносупрессивной ролью IL-10 (87–89). В совокупности эти результаты предполагают, что APCs интернализируют островковые EV, содержащие врожденные стимулы, которые приводят к экспрессии провоспалительных цитокинов.

    Хотя клетки CD4 + не поглощали электромобили, они могли быть активированы косвенно через APC.Предыдущие исследования показали, что профессиональные APC могут легко приобретать и представлять связанные с экзосомами антигены или белки, что приводит к стимуляции Т- или В-клеток (21, 23, 67). Наши результаты показывают, что воздействие ЭВ приводит к увеличению T H 1, T H 2 и T H 17 иммунных ответов в HC PBMC, причем наибольшее увеличение обнаруживается в процентном отношении CD4 + IFN- γ –продуцирующие клетки. Это примечательно, потому что T1D считался аутоиммунным заболеванием, опосредованным T H 1, в результате чего активация тканеспецифических Т-клеток, секретирующих IFN- γ , считается ключевым фактором аутоиммунного процесса (90).Было показано, что повышение уровней IFN-γ коррелирует с прогрессированием диабета у мышей NOD, а также является необходимым для диабета на вирусной модели (91, 92). Кроме того, клетки T H 17 участвуют в метаболических путях диабета и способствуют гибели бета-клеток (93). Примечательно, что увеличение количества Т-клеток, продуцирующих IL-17, было зарегистрировано у детей с ранним началом T1D (94, 95). Ранее было показано, что как IL-17, так и IFN-γ способствуют патогенезу T1D (96). Однако механически неизвестно, как эндогенные пути могут активировать клетки для производства провоспалительных цитокинов.

    Затем мы оценили, реагируют ли PBMC HC и T1D по-разному на островковые EV. Мы наблюдали общую активацию T- и B-лимфоцитов из HC и T1D с аналогичной величиной, измеренной по экспрессии маркера активации CD69, что указывает на их участие в качестве медиаторов как Т-, так и В-клеточного врожденного иммунного ответа. Воздействие ЭВ также вызвало усиление митоген-управляемой пролиферации Т- и В-клеток при НС и СД1 на аналогичных уровнях как в лимфоцитах, так и в Т-клетках CD4 + . Этот результат согласуется с предыдущими данными, показывающими, что EV могут действовать как носители антигена мощных иммуномодулирующих сигналов (16, 97).Однако ответ в CD19 + B-клетках был повышен при T1D по сравнению с HC. Мы еще не можем сделать вывод, был ли этот ответ обусловлен памятью, а не врожденным, или это явление объясняет повышенную продукцию антител против GAD65 в этих образцах.

    Зная, что островки человека выделяют ЭМ, которые несут аутоантигены диабета и модулируют иммунные ответы, мы затем определили, существует ли дифференциальный ответ памяти на эти ЭМ у пациентов с СД1 по сравнению с ГК.Предыдущие исследования показали, что нагруженные антигеном EV обладают потенциалом стимулировать ответы клеток памяти (21, 22, 98–100). Мы показали, что активация Т- и В-клеток памяти в ответ на ЭВ является избирательной для пациентов с СД1, что предполагает участие ЭВ в антиген-специфических ответах. Чтобы исследовать специфичность этого ответа на островковые антигены человека, мы использовали ELISA для антител GAD65, чтобы определить, могут ли EV индуцировать продукцию аутоантител in vitro . Продукция антитела GAD65 была обнаружена у пациентов с T1D in vitro при воздействии IL-2 и R848, которые, как известно, эффективно запускают экспансию и активацию В-клеток памяти (101, 102).Воздействие EV дополнительно индуцировало продукцию антител GAD65 в PBMC T1D. Однако продукция антител не была обнаружена в образцах HC PBMC ни при каких условиях. Пациенты с СД1, вероятно, предварительно подвергались воздействию островковых специфических антигенов во время развития болезненного состояния; по крайней мере одно аутоантитело выявляется у 90% пациентов (103, 104), а у 75–80% пациентов есть аутоантитела к GAD65 (104). Хотя GAD65-специфические аутоантитела обычно связаны с очень ранними стадиями патогенеза СД1 (105), накапливаются данные, свидетельствующие о том, что аутореактивные клетки памяти сохраняются с течением времени у пациентов с СД1 и могут активироваться при повторном воздействии антигена, как видно на обоих рисунках. трансплантация поджелудочной железы (106–108) и трансплантация островков (109, 110).Сигнал, доставляемый электромобилями, по-видимому, запускает аналогичный фенотип активации.

    Мы обнаружили, что ингибитор BTK ибрутиниб может возвращать EV-индуцированную активацию B-клеток памяти и выработку антител GAD65. Ибрутиниб подавляет функцию BTK, ключевой сигнальной молекулы рецепторного комплекса B-клеток, который способствует поддержанию и активации B-клеток. Аутореактивные B-клетки зависят от BTK для выживания больше, чем обычные B-клетки, что предполагает его потенциал в качестве терапевтической мишени при T1D (111).Интересно, что несколько ингибиторов BTK доказали свою эффективность на множестве доклинических моделей других аутоиммунных патологий (112–114). Например, на мышиной модели аутоиммунного артрита было показано, что ингибирование BTK подавляет индуцированный коллагеном артрит за счет снижения уровней аутоантител (115). В частности, в случае T1D было показано, что BTK способствует сохранению антиинсулиновых B-клеток (111), а у мышей NOD с дефицитом BTK сообщалось о снижении частоты T1D (116). Кроме того, тематическое исследование терапии ибрутинибом у двух пациентов с хроническим лимфолейкозом показало быстрое снижение уровня антиинсулиновых и анти-GAD65 антител после лечения (117).Мы и другие показали, что EV способны вызывать опосредованный B-клетками ответ памяти, а у мышей с дефицитом BTK снижены опосредованные EV ответы памяти (98). Мыши с дефицитом BTK все еще могут вызывать Т-зависимые иммунные ответы, что позволяет предположить, что точное нацеливание на BTK может иметь преимущество перед глобальным устранением B-клеток для лечения аутоиммунитета без индукции иммунодефицита. Это может быть многообещающим путем в лечении T1D, как в снижении активации аутореактивных B-клеток, так и в предотвращении взаимодействия EV с эффекторными клетками.

    Считается, что молекулярный профиль EV зависит от окружающей среды, и различные стрессы могут вызвать их образование и изменить их груз. Ранее мы показали, что процедура выделения островков вызывает воспалительную реакцию островков и стресс эндоплазматического ретикулума, от которого клетки постепенно восстанавливаются в течение нескольких дней в культуре (118–120). Этот ответ также отражается в терминах высвобождения EV, поскольку было обнаружено, что количество EV снижается со временем культивирования после выхода из изоляции (27).Кроме того, было показано, что обработка цитокинами как в клетках MIN6, так и в островках крысы индуцирует продукцию EV и изменяет их содержание белка и miRNA, влияя на их иммуногенность (28, 121). Недавние исследования подчеркнули уникальную роль специфического содержания EV, такого как miRNA, иммунные комплексы и протеасома 20S, которые сосуществуют на EV вместе со специфическими аутоантигенами, которые могут регулировать их иммуногенную активность (17, 63, 122). Такие EV могут впоследствии запускать сигнальные пути, приводя к воспалению или врожденным или приобретенным иммунным ответам.

    Хотя наши ЭМ происходят от доноров островков человека с HLA-идентичностью, отличной от таковой из PBMC, подвергшихся воздействию, мы не считаем, что это различие было основным фактором наших наблюдений. ЭВ были идентифицированы у реципиентов островковых трансплантатов, несущих донорский HLA, и предполагается, что они происходят из трансплантата (11). Однако тот факт, что реакции памяти пациентов с T1D так сильно отличались от ответов HCs, которые не отличались от таковых в контрольной группе, не подвергавшейся воздействию, является результатом, несовместимым с каким-либо эффектом несоответствия HLA.Производство аутоантиген-специфического ответа в форме антитела против GAD65 также вряд ли будет вызвано различиями HLA. Взятые вместе, эти результаты предполагают, что ЭВ могут иметь важное значение как для врожденного, так и для антиген-специфического иммунитета. Эти исследования могут указать на потенциальные терапевтические возможности лечения СД1 путем ингибирования клеток памяти после диагностики СД1 или путем подавления продукции ЭВ и их последующих эффектов.

    Сокращения:

      Сокращения:

    • APC

    • BMI

    • BTK

    • CFSE

      карбоксифлуоресцеин сукцинимидиловый эфир

    • диам.

    • DMSO

    • ELISA

      иммуноферментный анализ

    • EV

    • GAD65

      декарбоксилаза глутаминовой кислоты 65

    • IFG 9057 9057 9057

      LPS

    • MFI

      средняя интенсивность флуоресценции

    • NK

    • NOD

    • PBMC

      мононуклеарные клетки периферической крови

    • 84 9057 9006 84 PHA 9006 9006
    • T1D

    • T H

    • ZnT8

    Благодарности

    Эта работа была выполнена при поддержке Transplant Québec, ответственной за услуги по координации восстановления органов и получение согласия на исследования от семей доноров островков.Проточная цитометрия была выполнена в Исследовательском институте иммунофенотипирования Центра здоровья Университета Макгилла с помощью Мари Элен Лакомб и Екатерины Юрченко.

    Финансовая поддержка: Мы признательны за поддержку Канадской национальной программе исследований трансплантологии (S.P.) и Фонду Центра здоровья Университета Макгилла (Королевская больница Виктории).

    Вклад авторов: A.K.R., S.N., J.T., and S.П. оформил исследование. A.K.R. и С. провели эксперименты, собрали данные и проанализировали результаты. A.K.R., S.N., M.G., C.P.H. и S.P. выполнили изоляцию островков человека. Рукопись написали А.К.Р., С.Н. и С.П. Все авторы внесли свой вклад в редактирование рукописи.

    Описание раскрытия: Авторам нечего раскрывать.

    Список литературы

    1.

    Эйзенбарт

    GS

    .

    Сахарный диабет I.Хроническое аутоиммунное заболевание

    .

    N Engl J Med

    .

    1986

    ;

    314

    (

    21

    ):

    1360

    1368

    . 2.

    Acton

    RT

    ,

    Roseman

    JM

    .

    Новые перспективы. В этиологии, генетике, патогенезе и естественном течении диабета с ювенильным началом

    .

    J Med Assoc State Ala

    .

    1978

    ;

    48

    (

    4

    ):

    25

    29, 34–25, 37, passim

    .3.

    Аткинсон

    MA

    .

    Патогенез и естественное течение диабета 1 типа

    .

    Колд Спринг Харб Перспект Мед

    .

    2012

    ;

    2

    (

    11

    ):

    a007641

    . 4.

    Tang

    Q

    ,

    Adams

    JY

    ,

    Penaranda

    C

    ,

    Melli

    K

    ,

    Piaggio

    E

    ,

    Sgouroudis

    0ir

    E 900c4

    Salomon

    BL

    ,

    Bluestone

    JA

    .

    Центральная роль дефектной продукции интерлейкина-2 в запуске аутоиммунной деструкции островков

    .

    Иммунитет

    .

    2008

    ;

    28

    (

    5

    ):

    687

    697

    ,5.

    Pesenacker

    AM

    ,

    Wang

    AY

    ,

    Singh

    A

    ,

    Gillies

    J

    ,

    Kim

    Y

    ,

    Piccirillo

    CA

    4, 3 9004

    Haining

    WN

    ,

    Tebbutt

    SJ

    ,

    Panagiotopoulos

    C

    ,

    Левингс

    MK

    .

    Сигнатура регуляторного Т-клеточного гена является специфическим и чувствительным биомаркером для идентификации детей с впервые возникшим диабетом типа 1

    .

    Диабет

    .

    2016

    ;

    65

    (

    4

    ):

    1031

    1039

    ,6.

    Lehuen

    A

    ,

    Diana

    J

    ,

    Zaccone

    P

    ,

    Cooke

    A

    .

    Перекрестные помехи между иммунными клетками при диабете 1 типа

    .

    Нат Рев Иммунол

    .

    2010

    ;

    10

    (

    7

    ):

    501

    513

    ,7.

    Hughes

    JW

    ,

    Riddlesworth

    TD

    ,

    DiMeglio

    LA

    ,

    Miller

    км

    ,

    Rickels

    MR

    ,

    McGill

    JB

    Сеть клиник обмена T1D

    .

    Аутоиммунные заболевания у детей и взрослых с диабетом 1 типа из реестра клиник обмена T1D

    .

    Дж. Клин Эндокринол Метаб

    .

    2016

    ;

    101

    (

    12

    ):

    4931

    4937

    ,8.

    Korsgren

    S

    ,

    Molin

    Y

    ,

    Salmela

    K

    ,

    Lundgren

    T

    ,

    Melhus

    A

    ,

    Korsgren

    O

    .

    Об этиологии диабета 1 типа: новая модель на животных, показывающая решающую роль бактерий, вызывающих неблагоприятный ответ врожденного иммунитета

    .

    Ам Дж. Патол

    .

    2012

    ;

    181

    (

    5

    ):

    1735

    1748

    ,9.

    Тери

    C

    ,

    Ostrowski

    M

    ,

    Segura

    E

    .

    Мембранные везикулы как конвейеры иммунных ответов

    .

    Нат Рев Иммунол

    .

    2009

    ;

    9

    (

    8

    ):

    581

    593

    . 10.

    Коломбо

    M

    ,

    Raposo

    G

    ,

    Théry

    C

    .

    Биогенез, секреция и межклеточные взаимодействия экзосом и других внеклеточных везикул

    .

    Анну Rev Cell Dev Biol

    .

    2014

    ;

    30

    (

    1

    ):

    255

    289

    . 11.

    Валлабхаджосюла

    P

    ,

    Корутла

    L

    ,

    Habertheuer

    A

    ,

    Yu

    M

    ,

    Rostami

    S

    ,

    Yuan

    3

    Лю

    C

    ,

    Корутла

    V

    ,

    Koeberlein

    B

    ,

    Trofe-Clark

    J

    ,

    Rickels

    MR

    ,

    Naji

    A

    .

    Тканеспецифические биомаркеры экзосом для неинвазивного мониторинга иммунологического отторжения трансплантированной ткани

    .

    Дж. Клин Инвест

    .

    2017

    ;

    127

    (

    4

    ):

    1375

    1391

    . 12.

    Гарсия-Контрерас

    M

    ,

    Shah

    SH

    ,

    Tamayo

    A

    ,

    Роббинс

    PD

    ,

    Golberg

    RB

    ,

    Mendez

    Ricordi

    .

    Характеристики экзосом, происходящих из плазмы, выявляют отчетливую сигнатуру микроРНК при длительном диабете 1 типа

    .

    Научный сотрудник

    .

    2017

    ;

    7

    (

    1

    ):

    5998

    . 13.

    Chen

    Y

    ,

    Xie

    Y

    ,

    Xu

    L

    ,

    Zhan

    S

    ,

    Xiao

    Y

    ,

    Gao

    Y

    ,

    Wu

    ,

    Wu

    Ge

    W

    .

    Содержание белка и функциональные характеристики очищенных сывороткой экзосом пациентов с колоректальным раком, выявленные с помощью количественной протеомики

    .

    Инт Дж. Рак

    .

    2017

    ;

    140

    (

    4

    ):

    900

    913

    . 14.

    Ян

    KS

    ,

    Im

    H

    ,

    Hong

    S

    ,

    Pergolini

    I

    ,

    Del Castillo

    AF

    , 34 Wang

    000 R

    ,

    Clardy ,

    Huang

    CH

    ,

    Pille

    C

    ,

    Ferrone

    S

    ,

    Yang

    R

    ,

    Castro

    CM

    ,

    Lee

    H

    ,

    Del Castillo

    Del Castillo

    9000 ,

    Weissleder

    R

    .

    Многопараметрическое профилирование EV в плазме упрощает диагностику злокачественных новообразований поджелудочной железы

    .

    Научный перевод медицины

    .

    2017

    ;

    9

    (

    391

    ):

    eaal3226

    .15.

    Lee

    JY

    ,

    Park

    JK

    ,

    Lee

    EY

    ,

    Lee

    EB

    ,

    Song

    YW

    .

    Циркулирующие экзосомы пациентов с системной красной волчанкой вызывают провоспалительный иммунный ответ

    .

    Лечение артрита

    .

    2016

    ;

    18

    (

    1

    ):

    264

    ,16.

    Роббинс

    PD

    ,

    Морелли

    AE

    .

    Регуляция иммунных ответов внеклеточными везикулами

    .

    Нат Рев Иммунол

    .

    2014

    ;

    14

    (

    3

    ):

    195

    208

    . 17.

    Kimura

    K

    ,

    Hohjoh

    H

    ,

    Fukuoka

    M

    ,

    Sato

    W

    ,

    Oki

    S

    ,

    Tomi

    Camaguchi

    , 34 34 Camaguchi

    , 34

    Кондо

    Т

    ,

    Такахаши

    R

    ,

    Ямамура

    Т

    .

    Циркулирующие экзосомы подавляют индукцию регуляторных Т-клеток через let-7i при рассеянном склерозе

    .

    Нац Коммуна

    .

    2018

    ;

    9

    (

    1

    ):

    17

    . 18.

    Лю

    Q

    ,

    Рохас-Каналес

    DM

    ,

    Divito

    SJ

    ,

    Shufesky

    WJ

    ,

    Stolz

    DB

    ,

    Erdos

    Gull

    ,

    Gibson

    GA

    ,

    Watkins

    SC

    ,

    Larregina

    AT

    ,

    Morelli

    AE

    .

    Экзосомы, происходящие из донорских дендритных клеток, способствуют направленному на аллотрансплантат иммунному ответу

    .

    Дж. Клин Инвест

    .

    2016

    ;

    126

    (

    8

    ):

    2805

    2820

    ,19.

    Бак

    AH

    ,

    Coakley

    G

    ,

    Simbari

    F

    ,

    McSorley

    HJ

    ,

    Quintana

    JF

    ,

    Le Bihan

    T

    ,

    Abreu-Goodger

    C

    ,

    Lear

    M

    ,

    Harcus

    Y

    ,

    Ceroni

    A

    ,

    Babayan

    SA

    ,

    Blaxter

    M

    ,

    Ivens

    ,

    Майзелс

    РМ

    .

    Экзосомы, секретируемые паразитами-нематодами, переносят малые РНК в клетки млекопитающих и модулируют врожденный иммунитет

    .

    Нац Коммуна

    .

    2014

    ;

    5

    (

    1

    ):

    5488

    ,20.

    Тан

    L

    ,

    Wu

    H

    ,

    Лю

    Y

    ,

    Zhao

    M

    ,

    Li

    D

    ,

    Lu

    Q

    .

    Последние достижения экзосом в иммуномодуляции и аутоиммунных заболеваниях

    .

    Аутоиммунитет

    .

    2016

    ;

    49

    (

    6

    ):

    357

    365

    . 21.

    Гири

    PK

    ,

    Schorey

    JS

    .

    Экзосомы, полученные из макрофагов M. Bovis, инфицированных BCG, активируют антиген-специфические CD4 + и CD8 + Т-клетки in vitro и in vivo

    .

    PLoS One

    .

    2008

    ;

    3

    (

    6

    ):

    e2461

    .22.

    Walker

    JD

    ,

    Maier

    CL

    ,

    Pober

    JS

    .

    Эндотелиальные клетки человека, инфицированные цитомегаловирусом, могут стимулировать аллогенные CD4 + Т-клетки памяти, высвобождая антигенные экзосомы

    .

    Дж Иммунол

    .

    2009

    ;

    182

    (

    3

    ):

    1548

    1559

    . 23.

    Andre

    F

    ,

    Schartz

    NE

    ,

    Movassagh

    M

    ,

    Flament

    C

    ,

    Pautier

    P

    ,

    Morice

    P

    ,

    Pome

    Lhomme

    C

    ,

    Escudier

    B

    ,

    Le Chevalier

    T

    ,

    Tursz

    T

    ,

    Amigorena

    S

    ,

    Raposo

    G

    ,

    Angevin

    ,

    Angevin

    Цитвогель

    L

    .

    Злокачественные выпоты и экзосомы, происходящие из иммуногенных опухолей

    .

    Ланцет

    .

    2002

    ;

    360

    (

    9329

    ):

    295

    305

    . 24.

    Sheng

    H

    ,

    Hassanali

    S

    ,

    Nugent

    C

    ,

    Wen

    L

    ,

    Hamilton-Williams

    E

    ,

    Dias

    P

    ,

    Dias

    P

    ,

    .

    Экзосомы или микрочастицы, высвобождаемые инсулиномой, обладают иммуностимулирующим действием и могут активировать аутореактивные Т-клетки, спонтанно развивающиеся у мышей, не страдающих ожирением и диабетом

    .

    Дж Иммунол

    .

    2011

    ;

    187

    (

    4

    ):

    1591

    1600

    ,25.

    Башратян

    R

    ,

    Sheng

    H

    ,

    Regn

    D

    ,

    Rahman

    MJ

    ,

    Dai

    YD

    .

    Экзосомы, высвобождаемые инсулиномой, активируют аутореактивные В-клетки, подобные маргинальной зоне, которые эндогенно разрастаются у предиабетических мышей NOD

    .

    евро J Immunol

    .

    2013

    ;

    43

    (

    10

    ):

    2588

    2597

    .26.

    Рахман

    MJ

    ,

    Regn

    D

    ,

    Башратян

    R

    ,

    Dai

    YD

    .

    Экзосомы, высвобождаемые островковыми мезенхимальными стволовыми клетками, запускают аутоиммунные ответы у мышей NOD

    .

    Диабет

    .

    2014

    ;

    63

    (

    3

    ):

    1008

    1020

    ,27.

    Hasilo

    CP

    ,

    Negi

    S

    ,

    Allaeys

    I

    ,

    Cloutier

    N

    ,

    Rutman

    AK

    ,

    Gasparrini

    M 9004il, 3

    Thibault

    P

    ,

    Boilard

    É

    ,

    Paraskevas

    S

    .

    Наличие аутоантигенов диабета во внеклеточных пузырьках, происходящих из островков человека

    .

    Научный сотрудник

    .

    2017

    ;

    7

    (

    1

    ):

    5000

    ,28.

    Cianciaruso

    C

    ,

    Phelps

    EA

    ,

    Pasquier

    M

    ,

    Hamelin

    R

    ,

    Demurtas

    D

    ,

    Alibashe Ahmed

    3 M

    0

    3 P

    M

    0 P ,

    Hirosue

    S

    ,

    Swartz

    MA

    ,

    De Palma

    M

    ,

    Hubbell

    JA

    ,

    Baekkeskov

    S

    .

    Первичные β-клетки человека и крысы высвобождают внутриклеточные аутоантигены GAD65, IA-2 и проинсулин в экзосомах вместе с индуцированными цитокинами усилителями иммунитета

    .

    Диабет

    .

    2017

    ;

    66

    (

    2

    ):

    460

    473

    ,29.

    Caballero-Corbalán

    J

    ,

    Friberg

    AS

    ,

    Brandhorst

    H

    ,

    Nilsson

    B

    ,

    Andersson

    HH

    ,

    Felldin

    ,

    Felldin

    ,

    Felldin

    ,

    Salmela

    K

    ,

    Tibell

    A

    ,

    Tufveson

    G

    ,

    Korsgren

    O

    ,

    Brandhorst

    D

    .

    Vitacyte collagenase HA: новая смесь ферментов для эффективного выделения островков человека

    .

    Трансплантация

    .

    2009

    ;

    88

    (

    12

    ):

    1400

    1402

    .30.

    Balamurugan

    AN

    ,

    Loganathan

    G

    ,

    Bellin

    MD

    ,

    Wilhelm

    JJ

    ,

    Harmon

    J

    ,

    Anazawa

    T Sol4

    ,

    Anazawa

    T Sol4

    ,

    Радосевич

    DM

    ,

    Yuasa

    T

    ,

    Tiwari

    M

    ,

    Papas

    KK

    ,

    McCarthy

    R

    ,

    Sutherland

    DE

    J, 3

    .

    Новая смесь ферментов для увеличения урожайности и скорости трансплантации аутологичных и аллогенных продуктов островков человека

    .

    Трансплантация

    .

    2012

    ;

    93

    (

    7

    ):

    693

    702

    . 31.

    Ricordi

    C

    ,

    Lacy

    PE

    ,

    Finke

    EH

    ,

    Olack

    BJ

    ,

    Scharp

    DW

    .

    Автоматический метод выделения островков поджелудочной железы человека

    .

    Диабет

    .

    1988

    ;

    37

    (

    4

    ):

    413

    420

    . 56.

    Рутман

    AK

    ,

    Negi

    S

    ,

    Gasparrini

    M

    ,

    Hasilo

    C

    ,

    Tchervenkov

    J

    ,

    Paraskevas

    S

    . Данные из: Лечение ибрутинибом снижает процентное содержание В-клеток и В-клеток памяти в РВМС, не влияя на жизнеспособность клеток.

    . https: // figshare.com / s / e1a971e40f90d4c367ed.57.

    Волк

    П

    .

    Природа и значение тромбоцитов в плазме крови человека

    .

    Br J Haematol

    .

    1967

    ;

    13

    (

    3

    ):

    269

    288

    ,58.

    Гарсия-Контрерас

    M

    ,

    Брукс

    RW

    ,

    Boccuzzi

    L

    ,

    Роббинс

    PD

    ,

    Ricordi

    C

    .

    Экзосомы как биомаркеры и терапевтические инструменты при сахарном диабете 1 типа

    .

    Eur Rev Med Pharmacol Sci

    .

    2017

    ;

    21

    (

    12

    ):

    2940

    2956

    ,59.

    De Toro

    J

    ,

    Herschlik

    L

    ,

    Waldner

    C

    ,

    Mongini

    C

    .

    Новые роли экзосом в нормальных и патологических состояниях: новые идеи для диагностики и терапевтического применения

    .

    Фронт Иммунол

    .

    2015

    ;

    6

    :

    203

    .60.

    Yuana

    Y

    ,

    Sturk

    A

    ,

    Nieuwland

    R

    .

    Внеклеточные везикулы в физиологических и патологических состояниях

    .

    Кровь Ред.

    .

    2013

    ;

    27

    (

    1

    ):

    31

    39

    . 61.

    Valadi

    H

    ,

    Ekström

    K

    ,

    Bossios

    A

    ,

    Sjöstrand

    M

    ,

    Lee

    JJ

    ,

    Lötvall

    JO

    Опосредованный экзосомами перенос мРНК и микроРНК является новым механизмом генетического обмена между клетками

    .

    Нат Клетка Биол

    .

    2007

    ;

    9

    (

    6

    ):

    654

    659

    0,62.

    Александр

    M

    ,

    Hu

    R

    ,

    Runtsch

    MC

    ,

    Kagele

    DA

    ,

    Mosbruger

    TL

    ,

    Толмачева

    T

    ra, 34 Се 900

    Круглый

    JL

    ,

    Ward

    DM

    ,

    O’Connell

    RM

    .

    Доставляемые экзосомами микроРНК модулируют воспалительную реакцию на эндотоксин

    .

    Нац Коммуна

    .

    2015

    ;

    6

    (

    1

    ):

    7321

    0,63.

    Dieudé

    M

    ,

    Bell

    C

    ,

    Turgeon

    J

    ,

    Beillevaire

    D

    ,

    Pomerleau

    L

    ,

    Yang

    B 3,

    Yang

    B 3,

    Qi

    S

    ,

    Поддон

    N

    ,

    Béland

    C

    ,

    Dhahri

    W

    ,

    Cailhier

    JF

    ,

    Rousseau

    Mche

    , 3

    Ducati Lévesque

    T

    ,

    Lau

    A

    ,

    Rondeau

    C

    ,

    Gingras

    D

    ,

    Muruve

    D

    ,

    Rivard

    A

    ,

    Cardinal

    Cardinal

    ,

    C

    ,

    Desjardins

    M

    ,

    Boilard

    É

    ,

    Thibault

    P

    ,

    Эбер

    МДж

    .

    Ядро протеасомы 20S, активное в апоптотических экзосомоподобных пузырьках, индуцирует продукцию аутоантител и ускоряет отторжение

    .

    Научный перевод медицины

    .

    2015

    ;

    7

    (

    318

    ):

    318ra200

    .64.

    Choudhuri

    K

    ,

    Llodrá

    J

    ,

    Roth

    EW

    ,

    Tsai

    J

    ,

    Gordo

    S

    ,

    Wucherpfennig

    Wucherpfennig

    K

    Стокса

    DL

    ,

    Dustin

    ML

    .

    Поляризованное высвобождение микровезикул, обогащенных Т-клеточными рецепторами, в иммунологическом синапсе

    .

    Природа

    .

    2014

    ;

    507

    (

    7490

    ):

    118

    123

    0,65.

    Segura

    E

    ,

    Nicco

    C

    ,

    Lombard

    B

    ,

    Véron

    P

    ,

    Raposo

    G

    ,

    Batteux

    F

    na

    , 3 4 Amigore

    Тери

    С

    .

    ICAM-1 на экзосомах из зрелых дендритных клеток является критическим для эффективного примирования наивных Т-клеток

    .

    Кровь

    .

    2005

    ;

    106

    (

    1

    ):

    216

    223

    0,66.

    Bretz

    NP

    ,

    Ridinger

    J

    ,

    Rupp

    AK

    ,

    Rimbach

    K

    ,

    Keller

    S

    ,

    Rupp

    C

    ,

    Mar

    Уманский

    L

    ,

    Уманский

    V

    ,

    Eigenbrod

    T

    ,

    Sammar

    M

    ,

    Altevogt

    P

    .

    Экзосомы жидкости организма способствуют секреции воспалительных цитокинов в моноцитарных клетках посредством передачи сигналов Toll-подобного рецептора

    .

    Дж. Биол. Хим.

    .

    2013

    ;

    288

    (

    51

    ):

    36691

    36702

    0,67.

    Danesh

    A

    ,

    Inglis

    HC

    ,

    Jackman

    RP

    ,

    Wu

    S

    ,

    Deng

    X

    ,

    Muench

    MO

    ,

    Heitman

    Норрис

    PJ

    .

    Экзосомы из единиц эритроцитов связываются с моноцитами и индуцируют провоспалительные цитокины, усиливая Т-клеточные ответы in vitro

    .

    Кровь

    .

    2014

    ;

    123

    (

    5

    ):

    687

    696

    0,68.

    Бхатнагар

    S

    ,

    Schorey

    JS

    .

    Экзосомы, высвобождаемые из инфицированных макрофагов, содержат гликопептидолипидов Mycobacterium avium и являются провоспалительными

    .

    Дж. Биол. Хим.

    .

    2007

    ;

    282

    (

    35

    ):

    25779

    25789

    0,69.

    Nielsen

    CT

    ,

    Østergaard

    O

    ,

    Stener

    L

    ,

    Iversen

    LV

    ,

    Truedsson

    L

    ,

    Gullstrand

    B

    ,

    Gullstrand

    B

    ,

    Gullstrand

    B

    ,

    Heegaard

    NH

    .

    Повышение уровня IgG на микрочастицах клеточной плазмы при системной красной волчанке связано с аутоантителами и активацией комплемента

    .

    Насыщенный артрит

    .

    2012

    ;

    64

    (

    4

    ):

    1227

    1236

    0,70.

    Boilard

    E

    ,

    Nigrovic

    PA

    ,

    Larabee

    K

    ,

    Watts

    GF

    ,

    Coblyn

    JS

    ,

    Weinblatt

    , 34 ME

    Remold-O’Donnell

    E

    ,

    Farndale

    RW

    ,

    Ware

    J

    ,

    Lee

    DM

    .

    Тромбоциты усиливают воспаление при артрите за счет выработки коллаген-зависимых микрочастиц

    .

    Наука

    .

    2010

    ;

    327

    (

    5965

    ):

    580

    583

    ,71.

    Bhatnagar

    S

    ,

    Shinagawa

    K

    ,

    Castellino

    FJ

    ,

    Schorey

    JS

    .

    Экзосомы, высвобождаемые из макрофагов, инфицированных внутриклеточными патогенами, стимулируют провоспалительный ответ in vitro и in vivo

    .

    Кровь

    .

    2007

    ;

    110

    (

    9

    ):

    3234

    3244

    ,72.

    Okoye

    IS

    ,

    Coomes

    SM

    ,

    Pelly

    VS

    ,

    Czieso

    S

    ,

    Papayannopoulos

    V

    ,

    Tolmachova

    3

    04 Tolmachova

    3

    Уилсон

    MS

    .

    Экзосомы, содержащие микроРНК, происходящие из Т-регуляторных клеток, подавляют патогенные Т-хелперные клетки 1

    .

    Иммунитет

    .

    2014

    ;

    41

    (

    1

    ):

    89

    103

    ,73.

    Wieckowski

    EU

    ,

    Visus

    C

    ,

    Szajnik

    M

    ,

    Szczepanski

    MJ

    ,

    Storkus

    WJ

    ,

    004 TL

    .

    Микровезикулы опухолевого происхождения способствуют увеличению регуляторных Т-лимфоцитов и индуцируют апоптоз в опухолево-реактивных активированных CD8 + Т-лимфоцитах

    .

    Дж Иммунол

    .

    2009

    ;

    183

    (

    6

    ):

    3720

    3730

    ,74.

    Valenti

    R

    ,

    Huber

    V

    ,

    Filipazzi

    P

    ,

    Pilla

    L

    ,

    Sovena

    G

    ,

    Вилла

    A

    ,

    Corbelli

    ,

    Corbelli

    Fais

    S

    ,

    Parmiani

    G

    ,

    Rivoltini

    L

    .

    Микровезикулы, высвобождаемые опухолью человека, способствуют дифференцировке миелоидных клеток с опосредованной трансформирующим фактором роста бета супрессивной активностью в отношении Т-лимфоцитов

    .

    Cancer Res

    .

    2006

    ;

    66

    (

    18

    ):

    9290

    9298

    ,75.

    Wang

    GJ

    ,

    Liu

    Y

    ,

    Qin

    A

    ,

    Shah

    SV

    ,

    Deng

    ZB

    ,

    Xiang

    X

    ,

    Cheng

    Лю

    C

    ,

    Ван

    J

    ,

    Zhang

    L

    ,

    Grizzle

    WE

    ,

    Zhang

    HG

    .

    Частицы, подобные экзосомам тимуса, индуцируют регуляторные Т-клетки

    .

    Дж Иммунол

    .

    2008

    ;

    181

    (

    8

    ):

    5242

    5248

    .76.

    Liu

    C

    ,

    Yu

    S

    ,

    Zinn

    K

    ,

    Wang

    J

    ,

    Zhang

    L

    ,

    Jia

    Y

    ,

    004 Jia

    Barnes

    S

    ,

    Kimberly

    RP

    ,

    Grizzle

    WE

    ,

    Zhang

    HG

    .

    Экзосомы карциномы молочной железы мыши способствуют росту опухоли путем подавления функции NK-клеток

    .

    Дж Иммунол

    .

    2006

    ;

    176

    (

    3

    ):

    1375

    1385

    0,77.

    Eitan

    E

    ,

    Зеленый

    J

    ,

    Bodogai

    M

    ,

    Mode

    NA

    ,

    Baek

    R

    ,

    Jørgensen

    M

    ,

    Freeman

    ,

    Freeman

    ,

    Freeman

    Witwer

    K

    ,

    Zonderman

    A

    ,

    Biragyn

    A

    ,

    Mattson

    MP

    ,

    Noren

    Hooten

    N

    ,

    Evans

    M

    M

    Возрастные изменения характеристик внеклеточных пузырьков плазмы и интернализация лейкоцитами

    .

    Научный сотрудник

    .

    2017

    ;

    7

    (

    1

    ):

    1342

    0,78.

    Hazan-Halevy

    I

    ,

    Rosenblum

    D

    ,

    Weinstein

    S

    ,

    Bairey

    O

    ,

    Raanani

    P

    ,

    Peer

    D

    .

    Клеточно-специфическое поглощение экзосом, происходящих из лимфомы мантийных клеток, злокачественными и доброкачественными В-лимфоцитами

    .

    Раковые буквы

    .

    2015

    ;

    364

    (

    1

    ):

    59

    69

    0,79.

    Sadallah

    S

    ,

    Eken

    C

    ,

    Martin

    PJ

    ,

    Schifferli

    JA

    .

    Микрочастицы (эктосомы), выделяемые сохраненными тромбоцитами человека, подавляют регуляцию макрофагов и модифицируют развитие дендритных клеток

    .

    Дж Иммунол

    .

    2011

    ;

    186

    (

    11

    ):

    6543

    6552

    .80.

    Walters

    SB

    ,

    Kieckbusch

    J

    ,

    Nagalingam

    G

    ,

    Swain

    A

    ,

    Latham

    SL

    ,

    Grau

    GE

    J

    ,

    Гребни

    V

    ,

    Saunders

    BM

    .

    Микрочастицы из макрофагов, инфицированных микобактериями, способствуют воспалению и миграции клеток

    .

    Дж Иммунол

    .

    2013

    ;

    190

    (

    2

    ):

    669

    677

    ,81.

    Rapoport

    MJ

    ,

    Mor

    A

    ,

    Vardi

    P

    ,

    Ramot

    Y

    ,

    Winker

    R

    ,

    Hindi

    A

    , 34 Bist

    Снижение секреции цитокинов Th3 предшествует усиленной и замедленной секреции цитокинов Th2 в активированных мононуклеарных клетках периферической крови пациентов с инсулинозависимым сахарным диабетом

    .

    Дж Аутоиммунный

    .

    1998

    ;

    11

    (

    6

    ):

    635

    642

    ,82.

    Tchórzewski

    H

    ,

    Głowacka

    E

    ,

    Banasik

    M

    ,

    Lewkowicz

    P

    ,

    Szałapska-Zawodniak

    M

    .

    Активированные Т-лимфоциты пациентов с высоким риском сахарного диабета I типа обладают различной способностью продуцировать гамма-интерферон, интерлейкин-6 и интерлейкин-10 и претерпевают индуцированный анти-CD95 апоптоз после стимуляции инсулином

    .

    Иммунол Летт

    .

    2001

    ;

    75

    (

    3

    ):

    225

    234

    ,83.

    Карлссон Фаресйо

    MG

    ,

    Эрнеруд

    Дж

    ,

    Людвигссон

    Дж

    .

    Цитокиновый профиль у детей в первые 3 месяца после постановки диагноза сахарный диабет 1 типа

    .

    Сканд Дж. Иммунол

    .

    2004

    ;

    59

    (

    5

    ):

    517

    526

    0,84.

    Бэк

    HS

    ,

    Юн

    JW

    .

    Прямое участие макрофагов в разрушении бета-клеток, приводящее к развитию диабета у инфицированных вирусом мышей

    .

    Диабет

    .

    1991

    ;

    40

    (

    12

    ):

    1586

    1597

    ,85.

    Wegner

    M

    ,

    Araszkiewicz

    A

    ,

    Piorunska-Stolzmann

    M

    ,

    Wierusz-Wysocka

    B

    ,

    Zozulinska-

    Diolkiewicz.

    Связь между концентрацией IL-6 и переменными, связанными с диабетом, у пациентов с СД1 с микрососудистыми осложнениями и без них

    .

    Воспаление

    .

    2013

    ;

    36

    (

    3

    ):

    723

    728

    0,86.

    Mihara

    M

    ,

    Hashizume

    M

    ,

    Yoshida

    H

    ,

    Suzuki

    M

    ,

    Shiina

    M.

    Система рецепторов IL-6 / IL-6 и ее роль при физиологических и патологических состояниях

    .

    Clin Sci (Лондон)

    .

    2012

    ;

    122

    (

    4

    ):

    143

    159

    0,87.

    Ян

    Z

    ,

    Chen

    M

    ,

    Wu

    R

    ,

    Fialkow

    LB

    ,

    Bromberg

    JS

    ,

    McDuffie

    M

    ,

    Надлер

    JL

    .

    Подавление аутоиммунного диабета путем вирусного переноса гена IL-10

    .

    Дж Иммунол

    .

    2002

    ;

    168

    (

    12

    ):

    6479

    6485

    0,88.

    Taylor

    A

    ,

    Verhagen

    J

    ,

    Blaser

    K

    ,

    Akdis

    M

    ,

    Akdis

    CA

    .

    Механизмы подавления иммунитета интерлейкином-10 и трансформирующим фактором роста бета: роль регуляторных Т-клеток

    .

    Иммунология

    .

    2006

    ;

    117

    (

    4

    ):

    433

    442

    .89.

    Dénes

    B

    ,

    Fodor

    I

    ,

    Langridge

    WH

    .

    Аутоантигены плюс интерлейкин-10 подавляют аутоиммунитет к диабету

    .

    Диабет Технол Тер

    .

    2010

    ;

    12

    (

    8

    ):

    649

    661

    0,90.

    Liblau

    RS

    ,

    Singer

    SM

    ,

    McDevitt

    HO

    .

    Th2 и Th3 CD4 + Т-клетки в патогенезе органоспецифических аутоиммунных заболеваний

    .

    Иммунол Сегодня

    .

    1995

    ;

    16

    (

    1

    ):

    34

    38

    0,91.

    Schloot

    NC

    ,

    Hanifi-Moghaddam

    P

    ,

    Goebel

    C

    ,

    Shatavi

    SV

    ,

    Flohé

    S

    ,

    Kolb

    Hothe

    .

    Уровни IFN-гамма и IL-10 в сыворотке связаны с прогрессированием заболевания у мышей с диабетом, не страдающих ожирением

    .

    Diabetes Metab Res Ред.

    .

    2002

    ;

    18

    (

    1

    ):

    64

    70

    0,92.

    Савинов

    AY

    ,

    Wong

    FS

    ,

    Червонский

    AV

    .

    IFN-гамма влияет на самонаведение диабетогенных Т-клеток

    .

    Дж Иммунол

    .

    2001

    ;

    167

    (

    11

    ):

    6637

    6643

    0,93.

    Arif

    S

    ,

    Moore

    F

    ,

    Marks

    K

    ,

    Bouckenooghe

    T

    ,

    Dayan

    CM

    ,

    Planas

    R

    , 34 Vives

    ,

    Powrie

    J

    ,

    Tree

    T

    ,

    Marchetti

    P

    ,

    Huang

    GC

    ,

    Gurzov

    EN

    ,

    Pujol-Borrell

    R 900izirik

    R 900izirik ДЛ

    ,

    Пикман

    М

    .

    Активация периферического и островкового пути интерлейкина-17 характеризует аутоиммунный диабет человека и способствует опосредованной цитокинами гибели β-клеток

    .

    Диабет

    .

    2011

    ;

    60

    (

    8

    ):

    2112

    2119

    .94.

    Marwaha

    AK

    ,

    Crome

    SQ

    ,

    Panagiotopoulos

    C

    ,

    Berg

    KB

    ,

    Qin

    H

    ,

    Ouyang

    Q

    ,

    Q

    ,

    Priatel

    JJ

    ,

    Levings

    MK

    ,

    Tan

    R

    .

    Передний край: увеличение количества Т-клеток, секретирующих IL-17, у детей с впервые возникшим диабетом типа 1

    .

    Дж Иммунол

    .

    2010

    ;

    185

    (

    7

    ):

    3814

    3818

    0,95.

    McClymont

    SA

    ,

    Putnam

    AL

    ,

    Lee

    MR

    ,

    Esensten

    JH

    ,

    Liu

    W

    ,

    Hulme

    MA

    müller 900off,

    Hulme

    MA

    müller 900off

    Барон

    U

    ,

    Олек

    S

    ,

    Bluestone

    JA

    ,

    Brusko

    TM

    .

    Пластичность регуляторных Т-клеток человека у здоровых субъектов и пациентов с диабетом 1 типа

    .

    Дж Иммунол

    .

    2011

    ;

    186

    (

    7

    ):

    3918

    3926

    0,96.

    Девараджан

    П

    ,

    Чен

    З

    .

    Аутоиммунные эффекторные Т-клетки памяти: плохие и хорошие

    .

    Иммунол Рес

    .

    2013

    ;

    57

    (

    1-3

    ):

    12

    22

    .97.

    Théry

    C

    ,

    Amigorena

    S

    ,

    Raposo

    G

    ,

    Clayton

    A

    .

    Выделение и характеристика экзосом из супернатантов клеточных культур и биологических жидкостей

    .

    Curr Protoc Cell Biol

    .

    2006

    ;

    30

    (

    1

    ):

    3.22.1

    3.22.29

    .98.

    Qazi

    KR

    ,

    Gehrmann

    U

    ,

    Domange Jordö

    E

    ,

    Karlsson

    MC

    ,

    Gabrielsson

    S

    .

    Нагруженные антигеном экзосомы сами по себе индуцируют память Th2-типа посредством B-клеточно-зависимого механизма

    .

    Кровь

    .

    2009

    ;

    113

    (

    12

    ):

    2673

    2683

    .99.

    Хао

    S

    ,

    юаней

    J

    ,

    Xiang

    J

    .

    Неспецифические CD4 (+) Т-клетки с захватом экзосом, высвобождаемых антиген-специфическими дендритными клетками, стимулируют антигенспецифические ответы CD8 (+) CTL и долговременную Т-клеточную память

    .

    Дж Лейкок Биол

    .

    2007

    ;

    82

    (

    4

    ):

    829

    838

    . 100.

    Wakim

    LM

    ,

    Bevan

    MJ

    .

    Перекрестно одетые дендритные клетки управляют активацией CD8 + Т-клеток памяти после вирусной инфекции

    .

    Природа

    .

    2011

    ;

    471

    (

    7340

    ):

    629

    632

    .101.

    Jahnmatz

    M

    ,

    Kesa

    G

    ,

    Netterlid

    E

    ,

    Buisman

    AM

    ,

    Thorstensson

    R

    ,

    Ahlborg

    N

    .

    Оптимизация анализа ELISpot B-клеток человеческого IgG для анализа вакцин-индуцированных B-клеточных ответов

    .

    Дж. Иммунол Методы

    .

    2013

    ;

    391

    (

    1-2

    ):

    50

    59

    .102.

    Pinna

    D

    ,

    Corti

    D

    ,

    Jarrossay

    D

    ,

    Sallusto

    F

    ,

    Lanzavecchia

    A

    .

    Клональное вскрытие репертуара В-клеток памяти человека после инфицирования и вакцинации

    .

    евро J Immunol

    .

    2009

    ;

    39

    (

    5

    ):

    1260

    1270

    .103.

    Notkins

    AL

    ,

    Lernmark

    A

    .

    Аутоиммунный диабет 1 типа: решенные и нерешенные вопросы

    .

    Дж. Клин Инвест

    .

    2001

    ;

    108

    (

    9

    ):

    1247

    1252

    .104.

    Maclaren

    N

    ,

    Lan

    M

    ,

    Coutant

    R

    ,

    Schatz

    D

    ,

    Silverstein

    J

    ,

    Muir

    A

    , 3 Clare-

    Clare

    ,

    She

    JX

    ,

    Malone

    J

    ,

    Crockett

    S

    ,

    Schwartz

    S

    ,

    Quattrin

    T

    ,

    DeSilva

    M

    4 Vegt 9004 V

    ,

    Ноткинс

    А

    ,

    Кришер

    Дж

    .

    Только множественные аутоантитела к островковым клеткам (ICA), инсулину, GAD65, IA-2 и IA-2beta предсказывают иммуноопосредованный (тип 1) диабет у родственников

    .

    Дж Аутоиммунный

    .

    1999

    ;

    12

    (

    4

    ):

    279

    287

    .105.

    Лернмарк

    А

    .

    Декарбоксилаза глутаминовой кислоты — ген антигена болезни

    .

    Дж. Медицинский работник

    .

    1996

    ;

    240

    (

    5

    ):

    259

    277

    .106.

    Chujo

    D

    ,

    Foucat

    E

    ,

    Takita

    M

    ,

    Itoh

    T

    ,

    Sugimoto

    K

    ,

    Shimoda

    M

    ,

    ,

    Yamagishi

    M

    ,

    Tamura

    Y

    ,

    Yu

    L

    ,

    Naziruddin

    B

    ,

    Levy

    MF

    ,

    Ueno

    H

    , 3 .

    Появление широкого репертуара GAD65-специфических Т-клеток у пациентов с диабетом 1 типа с дисфункцией трансплантата после трансплантации аллогенных островков

    .

    Трансплантация клеток

    .

    2012

    ;

    21

    (

    12

    ):

    2783

    2795

    .107.

    Mujtaba

    MA

    ,

    Fridell

    J

    ,

    Книга

    B

    ,

    Faiz

    S

    ,

    Sharfuddin

    A

    ,

    Wiebke

    E 3,

    Табер

    Т

    .

    Повторное воздействие аутоантигенов бета-клеток у реципиентов аллотрансплантата поджелудочной железы с уже существующими аутоантителами к бета-клеткам

    .

    Клиническая трансплантация

    .

    2015

    ;

    29

    (

    11

    ):

    991

    996

    .108.

    Thivolet

    C

    ,

    Abou-Amara

    S

    ,

    Martin

    X

    ,

    Lefrancois

    N

    ,

    Petruzzo

    P

    ,

    McGregor

    B 900ss

    ,

    Dubernard

    JM

    .

    Серологические маркеры рецидивирующей деструкции бета-клеток у больных сахарным диабетом, перенесших трансплантацию поджелудочной железы

    .

    Трансплантация

    .

    2000

    ;

    69

    (

    1

    ):

    99

    103

    .109.

    Pugliese

    A

    ,

    Reijonen

    HK

    ,

    Nepom

    J

    ,

    Burke

    GW

    III.

    Рецидив аутоиммунитета у пациентов после трансплантации поджелудочной железы: обновление исследования

    .

    Диабет Менеджмент (Лондон)

    .

    2011

    ;

    1

    (

    2

    ):

    229

    238

    .110.

    Bosi

    E

    ,

    Braghi

    S

    ,

    Maffi

    P

    ,

    Scirpoli

    M

    ,

    Bertuzzi

    F

    ,

    Pozza

    G

    ,

    Pozza

    G

    ,

    Бонифачо

    E

    .

    Ответ аутоантител на трансплантацию островков при диабете 1 типа

    .

    Диабет

    .

    2001

    ;

    50

    (

    11

    ):

    2464

    2471

    .111.

    Bonami

    RH

    ,

    Sullivan

    AM

    ,

    Корпус

    JB

    ,

    Steinberg

    HE

    ,

    Hoek

    KL

    ,

    Khan

    WN

    13.

    Тирозинкиназа Брутона способствует сохранению зрелых антиинсулиновых В-клеток

    .

    Дж Иммунол

    .

    2014

    ;

    192

    (

    4

    ):

    1459

    1470

    .112.

    Honigberg

    LA

    ,

    Smith

    AM

    ,

    Sirisawad

    M

    ,

    Verner

    E

    ,

    Loury

    D

    ,

    Chang

    B

    ,

    Li

    Поддон

    Z

    ,

    Thamm

    DH

    ,

    Miller

    RA

    ,

    Багги

    JJ

    .

    Ингибитор тирозинкиназы Bruton PCI-32765 блокирует активацию B-клеток и эффективен в моделях аутоиммунных заболеваний и злокачественных новообразований B-клеток.

    .

    Proc Natl Acad Sci USA

    .

    2010

    ;

    107

    (

    29

    ):

    13075

    13080

    .113.

    Miklos

    D

    ,

    Cutler

    CS

    ,

    Arora

    M

    ,

    Waller

    EK

    ,

    Jagasia

    M

    ,

    Pusic

    I

    ,

    Цветы

    ,

    Логан

    AC

    ,

    Накамура

    R

    ,

    Blazar

    BR

    ,

    Li

    Y

    ,

    Chang

    S

    ,

    Lal

    I

    ,

    Дубовский

    ,

    J

    ,

    J Джеймс

    DF

    ,

    Стили

    L

    ,

    Ягловски

    S

    .

    Ибрутиниб при хронической реакции «трансплантат против хозяина» после неэффективности предшествующей терапии

    .

    Кровь

    .

    2017

    ;

    130

    (

    21

    ):

    2243

    2250

    .114.

    Crofford

    LJ

    ,

    Nyhoff

    LE

    ,

    Sheehan

    JH

    ,

    Kendall

    PL

    .

    Роль тирозинкиназы Брутона в аутоиммунных заболеваниях и значение для терапии

    .

    Эксперт Рев Клин Иммунол

    .

    2016

    ;

    12

    (

    7

    ):

    763

    773

    .115.

    Nyhoff

    LE

    ,

    Barron

    BL

    ,

    Johnson

    EM

    ,

    Bonami

    RH

    ,

    Maseda

    D

    ,

    Fensterheim

    Han

    ,

    Блэквелл

    TS

    ,

    Кроффорд

    LJ

    ,

    Кендалл

    PL

    .

    Дефицит тирозинкиназы Брутона подавляет аутоиммунный артрит у мышей, но не может блокировать опосредованный иммунными комплексами воспалительный артрит

    .

    Ревматический артрит

    .

    2016

    ;

    68

    (

    8

    ):

    1856

    1868

    .116.

    Кендалл

    PL

    ,

    Мур

    DJ

    ,

    Хулберт

    C

    ,

    Хук

    KL

    ,

    Хан

    WN

    ,

    Томас

    JW

    .

    Снижение диабета у мышей без ожирения с дефицитом btk и восстановление диабета с применением трансгена цепи IgH против инсулина

    .

    Дж Иммунол

    .

    2009

    ;

    183

    (

    10

    ):

    6403

    6412

    .117.

    Skrabs

    C

    ,

    Pickl

    WF

    ,

    Perkmann

    T

    ,

    Jager

    U

    ,

    Gessl

    A

    .

    Быстрое снижение уровня антител к инсулину и аутоантител к декарбоксилазе глутаминовой кислоты при терапии хронического лимфолейкоза ибрутинибом

    .

    Дж Клин Фарм Тер

    .

    2018

    ;

    43

    (

    1

    ):

    145

    149

    .118.

    Negi

    S

    ,

    Park

    SH

    ,

    Jetha

    A

    ,

    Aikin

    R

    ,

    Tremblay

    M

    ,

    Paraskevas

    S

    .

    Доказательства стресса эндоплазматического ретикулума, опосредующего гибель клеток в трансплантированных островках человека

    .

    Трансплантация клеток

    .

    2012

    ;

    21

    (

    5

    ):

    889

    900

    .119.

    Paraskevas

    S

    ,

    Maysinger

    D

    ,

    Wang

    R

    ,

    Duguid

    TP

    ,

    Rosenberg

    L

    .

    Потеря клеток в изолированных островках человека происходит в результате апоптоза

    .

    Поджелудочная железа

    .

    2000

    ;

    20

    (

    3

    ):

    270

    276

    . 120.

    Negi

    S

    ,

    Jetha

    A

    ,

    Aikin

    R

    ,

    Hasilo

    C

    ,

    Sladek

    R

    ,

    Paraskevas

    S

    .

    Анализ экспрессии генов бета-клеток выявляет воспалительную передачу сигналов и доказательства дедифференцировки после выделения островков человека и культивирования

    .

    PLoS One

    .

    2012

    ;

    7

    (

    1

    ):

    e30415

    .121.

    Guay

    C

    ,

    Menoud

    V

    ,

    Rome

    S

    ,

    Regazzi

    R

    .

    Горизонтальный перенос экзосомальных микроРНК трансдуцирует апоптотические сигналы между бета-клетками поджелудочной железы

    .

    Сигнал сотовой связи

    .

    2015

    ;

    13

    (

    1

    ):

    17

    .122.

    Cloutier

    N

    ,

    Tan

    S

    ,

    Boudreau

    LH

    ,

    Cramb

    C

    ,

    Subbaiah

    R

    ,

    Lahey

    L

    ,

    Albert

    ,

    Al

    Шнайдер

    R

    ,

    Gobezie

    R

    ,

    Nigrovic

    PA

    ,

    Farndale

    RW

    ,

    Robinson

    WH

    ,

    Brisson DM

    A Lee

    ,

    DM

    A Lee

    ,

    Бойлард

    E

    .

    Воздействие аутоантигенов микрочастицами лежит в основе образования мощных воспалительных компонентов: иммунных комплексов, связанных с микрочастицами

    .

    ЭМБО Мол Мед

    .

    2013

    ;

    5

    (

    2

    ):

    235

    249

    .

    Авторские права © 2018 Эндокринное общество

    (PDF) Тайна внеклеточных пузырьков красных кровяных телец при апноэ сна с метаболической дисфункцией

    Int.J. Mol. Sci. 2021,22, 4301 24 из 29

    128.

    Coughlan, C .; Брюс, К.Д .; Burgy, O .; Бойд, Т.Д .; Michel, C.R .; Garcia-Perez, J.E .; Adame, V .; Антон, П .; Bettcher, B.M .; Chial,

    H.J .; и другие. Выделение экзосом с помощью ультрацентрифугирования и осаждения и методы последующих анализов. Curr. Protoc.

    Cell Biol. 2020,88, e110. [PubMed]

    129.

    Zeng, Z .; Li, Y .; Pan, Y .; Lan, X .; Песня, F .; Sun, J .; Чжоу, К .; Лю, X .; Ren, X .; Ванга, Ф.; и другие. Произведенный из рака экзосомальный miR-25-3p

    способствует образованию дометастатической ниши, индуцируя проницаемость сосудов и ангиогенез. Nat. Commun.

    2018

    , 9, 5395.

    [CrossRef]

    130.

    Peng, L .; Li, Y .; Li, X .; Du, Y .; Li, L .; Hu, C .; Zhang, J .; Qin, Y .; Wei, Y .; Чжан, Х. Внеклеточные везикулы, полученные из интермиттирующих красных кровяных клеток, обработанных гипоксией

    , нарушают функцию эндотелия посредством регулирования фосфорилирования eNOS и экспрессии ЕТ-1.

    Cardiovasc. Наркотики Ther. 2020, 1–13. [CrossRef]

    131.

    Wu, M .; Ouyang, Y .; Wang, Z .; Zhang, R .; Huang, P.H .; Chen, C .; Li, H .; Li, P .; Quinn, D .; Дао, М .; и другие. Выделение экзосом

    из цельной крови путем интеграции акустики и микрофлюидики. Proc. Natl. Акад. Sci. США 2017,114, 10584–10589. [CrossRef]

    132.

    Witwer, K.W .; Buzas, E.I .; Bemis, L.T .; Bora, A .; Lasser, C .; Lotvall, J .; Nolte-’t Hoen, E.N .; Piper, M.G .; Сивараман, С.; Skog, J .; и другие.

    Стандартизация методов сбора, выделения и анализа проб при исследовании внеклеточных везикул. J. Extracell. Пузырьки

    2013

    , 2, 20360.

    [CrossRef] [PubMed]

    133.

    Li, X .; Corbett, A.L .; Taatizadeh, E .; Tasnim, N .; Little, J.P .; Garnis, C .; Daugaard, M .; Guns, E .; Hoorfar, M .; Ли, I.T.S. Проблемы

    и возможности в исследованиях экзосом — Перспективы биологии, инженерии и терапии рака.APL Bioeng.

    2019

    , 3, 011503.

    [CrossRef] [PubMed]

    134.

    Soekmadji, C .; Li, B .; Huang, Y .; Wang, H .; An, T .; Liu, C .; Pan, W .; Chen, J .; Cheung, L .; Falcon-Perez, J.M .; и другие. Будущее внеклеточных везикул

    как тераностика — отчет о встрече ISEV. J. Extracell. Vesicles 2020,9, 1809766. [CrossRef] [PubMed]

    135.

    Royo, F .; Thery, C .; Falcon-Perez, J.M .; Nieuwland, R .; Витвер, К. Методы разделения и характеристики внеклеточных везикул

    : результаты всемирного исследования, проведенного подкомитетом ISEV по строгости и стандартизации.Ячейки

    2020

    , 9, 1955.

    [CrossRef] [PubMed]

    136.

    Nguyen, D.B .; Ly, T.B .; Wesseling, M.C .; Хиттингер, М .; Торге, А .; Devitt, A .; Perrie, Y .; Бернхардт, I. Характеристика

    микровезикул, выделенных из красных кровяных телец человека. Клетка. Physiol. Biochem. 2016,38, 1085–1099. [CrossRef]

    137.

    Johnstone, R.M .; Adam, M .; Hammond, J.R .; Orr, L .; Turbide, C. Формирование пузырьков во время созревания ретикулоцитов. Ассоциация

    активностей плазматической мембраны с высвобожденными везикулами (экзосомами).J. Biol. Chem. 1987, 262, 9412–9420. [CrossRef]

    138.

    Tissot, J.D .; Рубин, О .; Канеллини, Г. Анализ и клиническая значимость микрочастиц красных кровяных телец. Curr Opin Hematol

    2010

    ,

    17, 571–577. [CrossRef]

    139.

    Wannez, A .; Devalet, B .; Chatelain, B .; Chatelain, C .; Dogne, J.M .; Mullier, F. Внеклеточные везикулы в концентратах красных кровяных телец:

    Обзор. Трансфус. Med. Ред. 2019, 33, 125–130.[CrossRef]

    140.

    Allan, D .; Thomas, P .; Лимбрик, А. Выделение и характеристика везикул 60 нм («нанопузырьков»), образующихся во время индуцированного ионофором A23187 расщепления человеческих эритроцитов

    . Biochem. J. 1980, 188, 881–887. [CrossRef]

    141.

    Minetti, G .; Egee, S .; Morsdorf, D .; Steffen, P .; Махро, А .; Achilli, C .; Ciana, A .; Wang, J .; Bouyer, G .; Бернхардт, I .; и другие. Красная ячейка

    исследования: Искусство и артефакты. Blood Rev.2013 г., 27, 91–101. [CrossRef]

    142.

    Lutz, H.U .; Богданова, А. Механизмы маркировки стареющих эритроцитов для клиренса у здоровых людей. Фронт. Physiol.

    2013

    , 4, 387.

    [CrossRef]

    143.

    Alaarg, A .; Schiffelers, R.M .; van Solinge, W.W .; ван Вейк, Р. Везикуляция эритроцитов при наследственной гемолитической анемии. Фронт.

    Physiol. 2013,4, 365. [CrossRef] [PubMed]

    144.

    Camus, S.M.; De Moraes, J.A .; Bonnin, P .; Abbyad, P .; Le Jeune, S .; Lionnet, F .; Loufrani, L .; Grimaud, L .; Lambry, J.C .; Charue, D .;

    и др. Циркулирующие микрочастицы клеточной мембраны переносят гем к эндотелиальным клеткам и запускают вазоокклюзии при серповидно-клеточной анемии.

    Кровь 2015,125, 3805–3814. [CrossRef] [PubMed]

    145.

    Keuren, J.F .; Magdeleyns, E.J .; Govers-Riemslag, J.W .; Lindhout, T .; Curvers, J. Влияние микрочастиц

    тромбоцитов, индуцированных накоплением, на фазу инициации и распространения свертывания крови.Br. J. Haematol. 2006, 134, 307–313. [CrossRef] [PubMed]

    146.

    Donadee, C .; Раат, штат Нью-Джерси; Каниас, Т .; Tejero, J .; Lee, J.S .; Kelley, E.E .; Чжао, X .; Liu, C .; Reynolds, H .; Азаров, И .; и другие. Оксид азота

    поглощается микрочастицами эритроцитов и внеклеточным гемоглобином как механизм повреждения накопления эритроцитов. Тираж

    2011,124, 465–476. [CrossRef]

    147.

    Acker, J.P .; Almizraq, R.J .; Millar, D .; Маурер-Спурей, Э.Скрининг эритроцитов на содержание внеклеточных пузырьков как показатель качества продукта

    . Переливание 2018,58, 2217–2226. [CrossRef]

    148.

    van der Pol, E .; Coumans, F.A .; Grootemaat, A.E .; Gardiner, C .; Сарджент, И.Л .; Harrison, P .; Sturk, A .; van Leeuwen, T.G .;

    Nieuwland, R. Распределение частиц экзосом и микровезикул по размерам, определенное с помощью просвечивающей электронной микроскопии, цитометрии потока

    , анализа отслеживания наночастиц и резистивного импульсного зондирования.J. Thromb. Гемост. 2014,12, 1182–1192. [CrossRef]

    149.

    Maas, S.L .; Broekman, M.L .; де Вридж, Дж. Настраиваемое резистивное импульсное зондирование для характеристики внеклеточных везикул. Методы

    Мол. Биол. 2017, 1545, 21–33.

    150.

    Chung, S.M .; Bae, O.N .; Lim, K.M .; Но, J.Y .; Ли, M.Y .; Jung, Y.S .; Чанг, Дж. Лизофосфатидная кислота индуцирует тромбогенную активность

    за счет воздействия фосфатидилсерина и образования прокоагулянтных микровезикул в эритроцитах человека.Артериосклер.

    Тромб. Васк. Биол. 2007 г., 27, 414–421. [CrossRef]

    151.

    Кина, Т .; Икута, К .; Такаяма, Э .; Wada, K .; Majumdar, A.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *