Оленьи рожки грибы ложные: где растут, как выглядят, съедобные или нет, как отличить от ядовитых

Оленьи рожки грибы ложные: где растут, как выглядят, съедобные или нет, как отличить от ядовитых

Содержание

где растут, как выглядят, съедобные или нет, как отличить от ядовитых

Грибы оленьи рожки являются редчайшими, по внешнему виду напоминают морской коралл. Вид также называют рогатиком или кораллом желтыми, медвежьей лапкой. Оленьи рожки относят к семейству Гомфовых грибов. Они являются базидиомицетами, на плодовом теле которых образуются споры.

Где растет рамария желтая

Оленьи рожки – это своеобразный по своему внешнему виду гриб, плодовое тело которого имеет множество разветвлений. Его главной особенностью является вертикальный рост. Латинское название рамарии – Ramaria flava. Класс растения – Агарикомицеты. Оно растет исключительно на земле, в хвойных, лиственных и смешанных лесах. Иногда в месте роста гриба появляются ведьмины круги и кривые линии. Они характерны для экземпляров, растущих у хвойных деревьев. Оленьи рожки относят к паразитам. Они селятся на больных деревьях, постепенно превращая их в труху.

Рогатик желтый встречается как группами, так и по одному грибу. В наибольшем количестве представлен в лесах Карелии, Приморского края и Кавказа. Последнее время грибы оленьи рожки стали встречаться и в Крыму. Из-за мягкости климата крымские грибы оленьи рожки собирают уже в начале лета. За пределами России они распространены в странах Центральной Европы. По причине своей редкости и уникальности гриб оленьи рожки занесен в Красную книгу. Поэтому официально он запрещен для сбора. Несмотря на это продукт используют не только в кулинарии, но и нетрадиционной медицине. Этому способствует обилие полезных свойств и богатый состав.

Как выглядит рогатик желтый

Свое название рогатик получил неслучайно. Грибы, фото которых размещено ниже, напоминают оленьи рога. Высота плодового тела может достигать 20 см. Диаметр гриба составляет 15 см. С землей плодовое тело соединяется своеобразной «кочерышкой». От нее идут множественные разветвления с усеченными концами. Цвет гриба варьируется от светло-желтого до насыщенно-оранжевого. У основания оттенок плодового тела не меняется, он практически всегда белый. Место разлома грязно-белое. Грибная мякоть слегка влажная, запах рогатиков травянистый.

Мякоть рогатиков зачастую готовят в кляре и маринуют в соусе

Виды оленьих рожек

В природе представлено несколько разновидностей оленьих рожек. Все они отличаются съедобностью и внешним видом. У каждого представителя имеются определенные особенности. Поэтому при сборе и приготовлении к ним должен быть индивидуальный подход. Рогатик желтый бывает следующих видов:

Съедобный или нет гриб рогатик желтый

Грибы оленьи рожки, фото которых можно увидеть ниже, считаются условно-съедобными. Их относят к четвертой категории в кулинарии. Они значительно уступают популярным разновидностям грибов, несмотря на это, их используют в пищу. Перед употреблением грибы необходимо классифицировать. Некоторые бывают невкусными. В пищу не рекомендуют употреблять старые грибы и те экземпляры, что росли неподалеку от хвойных деревьев. Для внутреннего приема не подходят и те оленьи рожки, которые растут вблизи дорог.

Полезные свойства грибов оленьи рожки

Грибы, похожие на кораллы желтого цвета, можно не только употреблять в пищу, но и использовать в лечебных целях. Особое распространение они получили в китайской медицине. Благодаря содержанию фитоагглютинина, аминокислот и стерина, продукт часто применяют для нормализации работы желудочно-кишечного тракта и очищения легких. Косметологи оленьи рожки используют для торможения процессов старения. Также считается, что гриб способен предотвращать рост злокачественных клеток и укреплять иммунную систему. К другим полезным свойствам рогатика относятся:

  • профилактика тромбоза путем укрепления сосудистых стенок;
  • нормализация работы ЦНС;
  • стабилизация дыхательной функции;
  • снижение риска развития онкологии;
  • выведение токсических веществ из организма;
  • улучшение состава крови;
  • укрепление иммунной системы;
  • благоприятное воздействие на работу мозга и память;
  • омолаживание кожных покровов.

Помимо прочего, оленьи рожки считаются чрезмерно питательными для человеческого организма. На 70% они состоят из диетического волокна. Специалисты утверждают, что медвежья лапка считается одним из ценнейших источников железа и кальция. Благодаря этому продукт можно использовать для профилактики и лечения различных заболеваний, вызванных авитаминозом.

Внимание! По вкусовым качествам рогатики напоминают нечто среднее между креветками и мясом курицы.

Как отличить грибы оленьи рожки от ложных

Желтый гриб, как и коралл имеет множество ядовитых двойников. Поэтому важно уметь отличать его от несъедобных собратьев. Ошибка в данном случае может стоить грибнику жизни. Главным параметром для оценки является цвет. Он не должен быть слишком ярким. Молодые экземпляры рогатиков отличаются молочным или бежевым окрасом.

Самым близким родственником является рамария красивая. Ядовитый гриб очень похож на оленьи рожки. Но на месте надлома мякоть становится красной. Верхушка разветвлений двойника отличается нежно-розовым цветом. У старых экземпляров эта область со временем приобретает буро-коричневый окрас. Специфический запах у этого вида отсутствует. Но его можно распознать по горькому вкусу. Он позволяет вовремя отказаться от употребления в пищу, что снижает риск отравления. По остальным признакам ложный двойник практически не отличим от оленьих рожек. Поэтому начинающие грибники могут ошибаться во время сбора.

По внешним признакам рамария красивая вызывает исключительно положительные впечатления

При случайном приеме рамарии красивой в пищу следует обратиться к врачу. Для предотвращения серьезных осложнений необходимо провести очищение пищеварительной системы. В этих целях применяют сорбенты и препараты, купирующие токсическое отравление. Может потребоваться помещение в стационар для введения лечебных растворов внутривенно.

Еще одним двойником рогатиков является рамария золотистая. К ее отличительным чертам относят насыщенный желтый цвет и плотную короткую ножку. Ширина плодового тела колеблется от 5 до 12 см. Двойник обладает приятным запахом и грибным нежным вкусом. Рамарию золотистую можно употреблять в пищу только в молодом возрасте.

Правила сбора грибов рогатиков желтых

Гриб медвежья лапа собирают в период с августа по сентябрь. При выборе следует обходить старые экземпляры. От них нет никакой пользы. Также не рекомендуется брать грибы, похоже на оленьи рожки, с пней деревьев. В этом случае существует риск наткнуться на ядовитые разновидности. Так как рогатики обладают свойством накапливать в себе радионуклиды и тяжелые металлы, следует обходить стороной промышленные объекты, автомобильные трассы и военные территории. Чем дальше от цивилизации будет располагаться поляна с оленьими рожками, тем ниже вероятность развития пищевого отравления.

Сбор осуществляют с помощью острого ножа. Срывать плодовое тело не рекомендуется. Это может повредить его хрупкую структуру. Желательно не хранить только что собранные рогатики слишком долго. Под воздействием воздуха и света они начинают портиться. Лучше сразу их перебрать и приготовить.

Перед кулинарной обработкой коралла желтого следует убедиться в съедобности. После этого оленьи рожки очищают от лесного мусора и грязи. Замачивать продукт перед готовкой не требуется. После мытья достаточно промокнуть его бумажной салфеткой для удаления влаги. Для сохранения полезных свойств и вкусовых качеств на долгое время рогатики маринуют и сушат.

Но самыми вкусными считают свежесобранные грибы. Их готовка не отнимает много времени. Достаточно отварить их или бросить на сковородку для жарки. Средняя продолжительность приготовления составляет 20 минут. Переваривать этот тип рогатиков не рекомендуется. Оленьи рожки отлично сочетаются с картофелем и мясом. Следует помнить, что продукт хорошо впитывает соль и пряности, поэтому злоупотреблять этим не стоит.

Важно! Оленьи рожки способны провоцировать аллергическую реакцию. Поэтому при их употреблении в пищу следует проявлять особую осторожность.

Фото грибов оленьи рожки

Фото и видео о грибах оленьи рожки помогут составить полную картину и понять, как отличить их от других представителей. Если нет уверенности в том, что рогатик съедобный, то от его употребления лучше отказаться.

Старые экземпляры имеют темный насыщенный цвет

Медвежью лапку можно использовать в качестве глистогонного средства

Детям до трех лет давать оленьи рожки не рекомендуется

Чем моложе рогатик, тем нежнее вкус его мякоти

Для использования в лечебных целях продукт подвергают сушке

Заключение

Грибы оленьи рожки стоит попробовать хотя бы единожды. При правильном приготовлении они могут стать настоящим украшением праздничного стола, которое может посоревноваться с деликатесами. При сборе гриба следует соблюдать осторожность, тщательно проштудировав общую информацию и рекомендации специалистов.

Ложные оленьи рожки грибы. Съедобные или нет грибы рогатики (оленьи ножки)?

Ложные оленьи рожки грибы. Съедобные или нет грибы рогатики (оленьи ножки)?

О том, съедобный гриб рогатик или нет, существует однозначный ответ – калоцеру есть можно, вреда она не принесет, но вкусовые качества её весьма сомнительны. Многие кулинары считают эти качества весьма низкими из-за резинистой мякоти калоцеры. В пищевых целях рогатник собирается крайне редко, употребляется варены, жареным и сушеным.

Применение в кулинарии: В Болгарии съедобный гриб рогатик из-за красивого цвета используют в отварном виде как украшение в холодных закусках. Кроме того клейкую калоцеру добавляют в холодец перед его застыванием.

grib-info.ru

Гриб оленьи рожки (коралл, рогатик) по-научному называется рамария золотистая или рамария желтая. Дело в том, что это два разных вида, однако настолько похожих, что отличить их могут лишь опытные биологи в лабораторных условиях. Морфологические данные и вкусовые качества у этих разновидностей практически идентичны. Гриб оленьи рожки часто можно встретить в сосняках на белом мхе. Нередко встречаются очень большие экземпляры — весом около 1 кг. Иногда для того чтобы приготовить обед для всей семьи, хватает всего нескольких рогатиков. Черви данный макромицет не поражают, за исключением проволочника. Интересным фактом является то, что многие «тихие охотники» проходят мимо этих удивительных грибов, даже не подозревая, что они съедобные.

Съедобность

Грибы оленьи рожки, несмотря на свою экзотическую внешность, съедобны. Их относят к четвертой грибной категории. Лучше всего употреблять в пищу молодые экземпляры. Старые грибы имеют неприятный привкус, а также в них появляется горечь. Гриб оленьи рожки используют в кулинарии для приготовления различных блюд. Его можно солить, жарить, варить из него суп, однако лучше всего рогатик подходит для приготовления вторых блюд. Оленьи рожки по вкусу напоминают курицу или креветки (в зависимости от способа приготовления). У них необычно нежная мякоть.

Описание

Оленьи рожки – грибы, тело которых разрастается вертикально и напоминает ветвящийся морской коралл или оленьи рога, за что они и получили свои народные названия. Средний экземпляр в ширину достигает 7-16 см, однако встречаются грибы, превышающие в ширину 20 см. Интересным фактом является то, что их высота, как правило, совпадает с шириной. Окраска у рогатика желтая, золотисто-желтая или светло-коричневая. У старых экземпляров она ярко-оранжевая.

Мякоть золотисто-белая, водянистая, очень хрупкая и нежная, с приятным запахом. На воздухе при разломе или разрезе она быстро меняет цвет на бурый (с красным оттенком). У перезревших грибов при надавливании на ножку мякоть приобретает красный или кроваво-красный оттенок. Плодовое тело состоит из множества веточек с тупыми кончиками. Внешне макромицет напоминает коралл. Поверхность его сухая, гладкая и матовая.

Распространение

Гриб оленьи рожки распространен в умеренном и северном поясах Евразии и Северной Америки. Произрастает группами, предпочитает мшистые и влажные участки грунта в хвойных, смешанных и лиственных лесах. Иногда образует большие сообщества, может расти рядами или дугами, образуя «ведьмины кольца». Особенно рогатик любит сосняки, однако не брезгует и буково-грабовыми массивами. Встречается в нижнем и среднем поясе гор. Оптимальное время для сбора – август-октябрь. В южных регионах оленьи рожки собирают даже в зимнее время.

Особенности

У оленьих рожек, или рамарии золотистой (желтой), имеется достаточно много двойников – похожих на них коралловидных грибов. Однако все они являются несъедобными, а некоторые – ядовитыми. Для опытного человека отличить рогатик от других не составит труда. Однако если грибник имеет не слишком большой опыт или вообще является новичком, то лучше не «охотиться» на грибы оленьи рожки. Фотографии их имеются в данной статье.

Гриб оленья борода. Ежовик гребенчатый (Hericium erinaceus)

Ежовик гребёнчатый имеет множество названий. В Англии он больше известен как львиная грива, во Франции — Пом-Пом (Pom-Pom blanc), в Японии — ямабушитаке (ямабуситакэ), в Китае — хоутоугу. У нас этот гриб дедовой бородой, грибной лапшой, обезьяньей бородой, бородатым зубом. В научных изданиях чаще всего именуется как гериций гребенчатый.

Встретить львиную гриву в дикой природе можно на территории Амурской области, Хабаровского и Приморского краёв, предгорьях Крыма и Кавказа. Растёт на упавших и заболевших стволах березы, бука, дуба с первой декады августа по последнюю декаду сентября. Как правило плодовое тело появляется в местах отхода коры.

Плодовое тело одного гриба может достигать 18-20 см. и веса 1,2-1,6 кг. Цвет варьируется от светло-кремового до светло-бежевого. Мякоть беловатого цвета, довольно мясистая, при высыхании желтеющая. Свисающие тонкие иголочки образуют геминофор. На вкус приятный, напоминающий мясо креветок.

Ежовик гребенчатый признан съедобным грибом с огромным лечебным потенциалом. Он обладает антибактериальными и противовоспалительными свойствами. На его основе изготавливаются лекарства, помогающие бороться с хроническим гастритом, раком желудка, лейкомией. Уникальное свойство восстановления нервных клеток в головном мозге делает львиную гриву успешной для лечения болезни Альцгеймера, Паркисона, слабоумия, старческого склероза. Постоянное употребление ямабушитаке вылечивает (предупреждает) гастрит, в том числе хронический.

Львиная грива довольно редок в природе. Стоимость дикого гриба колеблется от 500 до 3000 евро, поэтому в дикой природе за ним идёт настоящая не тихая охота (особенно в Приморском крае со стороны китайских товарищей). Довольно широко культивируется искусственно в Китае и Франции, но лечебная ценность и стоимость искусственно выращенных грибов намного ниже, чем у «дикарей». В России в последнее время тоже научились выращивать грибную лапшу. Выращивание не требует особых сложностей, а мицелий без труда можно купить в многочисленных интернет-магазинах.

Как чистить оленьи рожки. Гриб «оленьи рожки». Как собирать, что можно приготовить, и чем приятны «рогатики»

Даже опытного грибника гриб «оленьи рожки» может повергнуть в недоумение. На первый взгляд даже не скажешь, что перед тобой объект «тихой охоты». Скорее, сооружение походит на коралл, по какой-то причуде выросший посреди леса. Из-за экзотической внешности мало кто догадывается, что грибы «оленьи рожки» съедобные. Между тем они не только не причинят вреда организму, но еще и доставят удовольствие едоку – правда, если собраны молодые экземплярчики. Старые начинают горчить, хотя и это поправимо (если, конечно, знать, как это делается).

Что такое «рогатики»

Это второе название, под которым известен гриб «оленьи рожки». Еще его зачастую называют коралловым, и понятно, почему. Дорастать он может до веса в килограмм, так что в состоянии накормить в одиночку целую семью. Черви почему-то избегают «рогатиков», так что с этой стороны разочарований ожидать не стоит. Запах у них вполне привлекателен, за исключением совсем уж возрастных «особей». Ядовитых подражателей у гриба в природе не существует, что тоже приятно. Перепутать с чем-нибудь непригодным в пищу их невозможно – за это нужно благодарить нестандартную внешность, которую имеют «оленьи рожки». Грибы как готовить, тоже понять несложно: все рецепты, касающиеся основной массы лесных собратьев, годятся и для «рогатиков».

На первое: грибной супчик

Итак, предположим, вы принесли из леса грибы «оленьи рожки». Приготовление обеда начнется с их подготовки. Собранные «кораллы» (треть кило) промываются несколько раз, непременно под проточной водой, поскольку из-за извилистой структуры грязь и мусор из них уходят неохотно. После они полчаса варятся в не слишком большой кастрюльке. Отвар выливается, поскольку, несмотря на все усилия, все равно содержит в себе определенное количество грязи. Грибочки промываются снова, заливаются чистой водой, и варка повторяется, но уже всего треть часа. Повторяем все манипуляции, и, наконец, гриб «оленьи рожки» в первом приближении готов к дальнейшей обработке. В холодную воду опускаются брусочки двух картошек, следом идут кружки половинки крупной морковки. Листик лаврушки – и на огонь. Когда овощи наполовину сварятся, к ним всыпаются грибы и кладется маленький кусочек сливочного масла. Минут через десять добавляются нарубленная луковка и пара чесночин пластинками. После закипания супчик сдабривается солью, перцем, зеленью, и фактически сразу огонь гасится. Суп, основой которого стал гриб «оленьи рожки», хорош и в горячем, и в холодном виде. А если в тарелку добавить ложку сметаны – вообще язык проглотить можно!

На второе: картошка с грибами

Любимые клубни пойдут и в жареном виде, и в виде пюре. Для обоих гарниров гриб «оленьи рожки», промытый как можно старательней, варится не дольше пяти минут в слабо булькающей воде. Если она сильно кипит, просто ключом бьет, «кораллы» станут вялыми и будут расползаться. Отцеженные «рогатики» режутся произвольным образом и жарятся с луком в сливочном масле. Далее можно пойти разными путями:

  1. Почти до готовности обжарить картошку в другой сковородке, присоединить к ней также почти готовый гриб «оленьи рожки» и протушить немножко под крышкой.
  2. Делается традиционное пюре – с молоком, с маслом, воздушное. Оно раскладывается по тарелкам, а сверху выкладывается грибная зажарка, доведенная до конечной готовности.

И то, и другое – обалденно вкусно!

На закуску: соленые грибы

Мало кто откажется от соленостей в зимние холодные месяцы. А уж грибочки в этом качестве остаются непревзойденными! Засолить без труда можно и гриб «оленьи рожки». Желательно перед засолом его не мыть, дабы не напитывать лишней влагой. Обычно для удаления сора довольно зачистки щеткой. После довольно крупно нарезанные рогатики плотно укладываются в достаточно просторную емкость с пересыпанием слоев солью (граммов сорок на каждый килограмм «кораллов»). Далее ведро прикрывается чисто марлей или тонкой тканью, а сверху размещается увесистый гнет. Пряности будут лишними – убьют приятный натуральный грибной аромат. Хранить засолку прямо так, в холодильнике или, для счастливчиков, в имеющемся подполе.

Сдобрим: грибной соус на все случаи жизни

Подливки, соусы и кетчупы могут превратить в шедевр даже самое убогое блюдо. Если вы любите субпродукты, вареное мясо, а яйца предпочитаете дополнять приятными субстанциями, вам должен понравиться соус, основой для которого послужит гриб «оленьи рожки». Граммов 200 рогатиков отвариваются по уже описанным правилам. В трех ложках растопленного масла обжаривается столько же муки до золотистости. Далее, с интенсивным помешиванием, вливается молоко (полтора стакана). После получения довольно густой, но однородной массы, добавляется еще полстакана молока, в котором разболтаны два желтка и стакан бульона (хотелось бы – грибного, но можно взять и мясной) плюс специи с солью. После закипания соус снимается с огня, дополняется половиной чашки молока и нарубленными грибами. Четверть часа тушения, введенная ложка сливочного масла – и соус покорит вас навсегда.

Оленьи рожки домашний цветок. Пять причин завести у себя дома «оленьи рога»

«Девушка, вам нужны «оленьи рога»?» — спросила меня бабуля, торгующая цветами. Вот только рогов мне еще не доставало, подумала я. Но к прилавку все-таки вернулась. Цветок был действительно в форме рогов. Его декоративность меня и подкупила. Взяла не раздумывая. Мой любимчик платицериум! У этого необычного цветка несколько названий — это и плоскорог, и папоротник эпифитный, но ботаническое название — платицериум. Строение листьев сильно рассеченное, по форме напоминающее оленьи рога. Видимо, именно поэтому в простонародье его так и назвали.Цвет листьев светло-зеленый с восковым налетом и мелкими чешуйками-волосками. Большие рогатые листья смотрят вверх и вниз, что придает цветку декоративность. Их длина достигает полуметра. Листья у этого цветка ни в коем случае не надо протирать. Чешуйки его позволяют растению удерживать влагу. Новые побеги выходят из круглого коричневого листа.Если вы новичок в комнатном цветоводстве и любите декоративно-лиственные растения так же, как люблю их я, то вам тем более надо завести «оленьи рога».

первая причина
первое и самое главное, на мой взгляд, достоинство этого комнатного растения — его неприхотливость в уходе. платицериум, как и все папоротники, очень любит обильный полив и высокую влажность. воду он предпочитает теплую, отстоянную. летом любит, чтобы его опрыскивали. можно также погружать горшок в воду. ему это тоже очень нравится. главное, не допускать пересыхания земляного кома — тогда листья начинают вянуть и «рожки» опускаются. зимой температура +15…+17°с его вполне устраивает. пересаживать часто его не надо. главное, в горшке должен быть хороший слой дренажа.
вторая причина
оленьи рога, как и хлорофитум, очищают воздух в жилых помещениях. они насыщают окружающее пространство веществами, губительными для болезнетворных бактерий, так называемыми фитонцидами, которые присутствуют в луке, чесноке, сосновом воздухе и много еще где.
третья причина
растет этот вид папоротника медленно, и его можно подвесить в кашпо, что является важным преимуществом при недостатке площадей, особенно в весенний период, когда подоконники заставлены рассадой.
четвертая причина
это декоративность цветка. пока растение молодо и полно сил, стоит попробовать выращивать его в природных для цветка условиях — на коряге или куске коры. но это, конечно, для любителей экспериментов. так платицериум, конечно, будет выглядеть эффектнее. но для такой посадки корни цветка необходимо завернуть мхом сфагнумом. стебель подвязать к опоре. главное условие такого оформления — частое опрыскивание.

Пятая причина

Завести у себя платицериум — это значит перенести экзотику субтропиков Африки и Австралии к себе домой.
Да, еще чуть не забыла предупредить, ни в коем случае не срезайте круглый коричневый лист, как сделала я вначале при покупке! К счастью, он нарастил новый и гораздо больший коричневый лист. Но я некоторое время провела в ожидании неприятностей. Оказывается, он — тоже очень необходимая часть растения. Хотя со временем я поняла, что именно он и придает растению некоторый шарм и декоративность. Так что если вам приглянулся мой любимчик, то смело приобретайте! Он вас не разочарует никогда!
Круглый коричневый лист, который не надо срезать!

Видео собираем Оленьи рожки!!!

Гриб оленьи рожки картинка — BookCooks.ru

Гриб оленьи рожки выделяется необычной формой и цветом среди остальных грибов. Свое название он получил, потому что его форма напоминает рога оленя или морские кораллы.

Описание гриба Оленьи рожки

Описание внешнего вида гриба

Оленьи рожки – это съедобный гриб. Его надземная часть имеет много разветвлений и небольшие образования, напоминающие шипы длиной 10-20 мм. Ширина его тела 20-30 см. Есть тонкие, ломкие «ушки». Из паразитов ему вредит только проволочник.

Цвет гриба зависит от фазы его роста. Молодые оленьи рожки имеют светло-желтый окрас, с возрастом он темнеет и становится ярко-оранжевым. Он не имеет привычного грибного запаха.

Ирина Селютина (Биолог):

Как вид, гриб был описан в 1755 г. французским ботаником Жозефом де Турнефором. Однако свое научное название – рамария желтая (Ramaria flava), этот вид получил лишь спустя 133 г в 1888 г благодаря Люсьену Келе – основателю Французского микологического общества.

Коралловые грибы, к которым относится данный вид считаются базидиомицетами. Споры у них образуются на всей поверхности плодового тела, т.к. спороносный слой расположен на внешней стороне.

Рамария, он же оленьи рожки встречается на поверхности почвы и на гнилой древесине или пнях во всех типах лесов. Найти плодовые тела можно в августе-сентябре, при хорошей погоде до октября. Среди множества видов ядовитые не встречаются, но есть разделение на условно-съедобные и съедобные. Лучше есть только молодые организмы, потому что более старые грибы имеют горький вкус.

Оленьи рожки собирают с августа по октябрь. Они растут небольшими колониями, поэтому их несложно собирать. Также из этого вида грибов получаются вкусные первые блюда.

Виды гриба

Гриб оленьи рожки имеет несколько сходных видов:

  1. Рогатик гроздевой: это белой гриб окраски, который с возрастом приобретает светло-розовый оттенок. Его ветки достигают высоты 15-20 см, а диаметр – 10-15 см.
  2. Гроздевик коралловидный: его тело имеет густые, тонкие белые ответвления. Мякоть нежная, но с возрастом становится более жесткой.
  3. Рогатик пурпуровый: гриб небольшого размера, длина его тела составляет 10 см, диаметр – 4-5 см. Ярко выраженного вкуса и запаха нет.
  4. Рогатик золотисто-желтый: имеет толстые «ветви» светло-желтого цвета. Его сбор начинает в конце августа-начале сентября.
  5. Рогатик гребенчатый: достигает в высоту 5 см. «Ветви» имеют гребенчатые, острые кончики.

Полезные свойства

В составе присутствуют аминокислоты (метионин и триптофан), а также липиды, фитоагглютинин и стерин. Гриб часто применяют в китайской медицине для лечения заболеваний ЖКТ и улучшения работы легких.

Также он обладает противоопухолевым эффектом и укрепляет иммунную систему. Оленьи рожки используют в косметологии для замедления процесса старения.

Калорийность гриба оленьи рожки, или рамария желтая составляет 55 ккал на 100 г продукта. Такая высокая калорийность позволяет использовать ее в приготовлении различных блюд. Гриб прекрасно подойдет и для вегетарианского меню.

Противопоказания

Этот гриб имеет как и остальные виды определенные противопоказания. К ним относятся:

  • детский возраст до 12 лет;
  • беременность и лактационный период;
  • хронические заболевания ЖКТ;
  • индивидуальная непереносимость (аллергия).

Следует быть осторожным при сборе, потому что у него существуют несъедобные двойники.

Перед готовкой их следует тщательно промывать под проточной водой. Не стоит собирать эти грибы рядом с трассами и крупными промышленными предприятиями.

Применение

Гриб используют в лечебных целях

Этот вид часто используется в народной медицине. Из него готовят лекарства для суставов и очищения организма от гельминтов (плоских, круглых, ленточных червей).

Ирина Селютина (Биолог):

Рамария желтая, или оленьи рожки нашла свое применение в косметологии. Здесь она используется для проведения омолаживающих процедур. Обосновано ее применение в данной области способностью удерживать влагу в эпителии кожи, которая значительно больше, чем такое же свойство глицерина и гиалуроновой кислоты. Ее природные полисахариды доставляют полезные вещества в глубокие слои кожи, а входящий в состав витамин D становится активатором процессом метаболизма в коже.

Также используют и в кулинарии. Особенно хорошо рожки подходят для маринования и сушки. Из них получаются вкусные супы и грибная икра.

В кулинарии

Не смотря на то, что рамария относится по своим вкусовым качествам к 4 вкусовой категории из-за характерной горечи, все же молодые грибы используют в кулинарии. Однако для этих целей лучше всего подходят только молодые экземпляры и и основания, т. к. «веточки» горчат.

Свежие оленьи рожки моют, режут на мелкие кусочки и отваривают.

Также из этого вида получаются вкусные соусы и начинки для несладкой выпечки. Вкус готовых оленьих рожек похож на морепродукты или отваренную курицу. Принесенные из леса грибы перебирают, там, где это требуется – срезается нижняя часть ножки с кусочками дерна. Промывают и затем проваривают 15-30 минут в подсоленной воде. После этого отвар сливают и для других блюд не используют.

Для грибного салата берут:

  • отваренные грибочки – 150 г;
  • морковь – 150 г;
  • небольшая луковица – 1шт.;
  • уксус – 2 ст.л.;
  • подсолнечное масло – 1 ст.л.;
  • чеснок – 2 зубчика;
  • соль, перец, зелень по вкусу.

Мелко нарезанные грибы соединяют с морковью и чесноком. Затем солят, добавляют перец и зелень, заправляют растительным маслом, дают настояться 30 минут. В это время лук нарезают кольцами, маринуют и смешивают с салатом.

Особенно нежный вкус имеют маринованные оленьи рожки. Для их приготовления необходимо взять: лимонный сок, яблочный уксус, черный перец и растительное масло. Своим видом маринованные рожки напоминают кораллы.

Рецепт первого блюда:

  • грибы – 400 г;
  • морковь – 150 г;
  • картофель – 400 г;
  • сыр твердый – 150 г;
  • сливочное масло – 50 г;
  • соль, перец, зелень по вкусу.

Грибы отваривают 30 минут, режут на мелкие части. Овощи так же измельчают и бросают в кастрюлю.

К отваренным овощам добавляют грибы, соль, перец и зелень и оставляют на маленьком огне на 15 минут. Затем добавляют натертый сыр и сливочное масло, при желании перед употреблением добавляют соус из сливок или сметаны.

В медицине

Для борьбы с язвой желудка можно приготовить лечебную настойку по следующему рецепту:

  • 150 г свежих грибов тщательно промыть,просушить и поместить в холодильник на 2 дня.
  • Подготовленные грибы разрезать на небольшие кусочки и залить 500 мл спирта или качественной водки;
  • Оставить для настаивания в темном месте на 30 дней, затем процедить. После этого начинают лечение.

При язве пьют 1 ст. л. лекарства три раза в день перед едой. Период лечения длится месяц, потом делают перерыв 14 дней и повторяют курс.

Леса России полны причудливыми макромицетами. Из-за необычного внешнего вида – сходства с рогами оленя – гриб отдела высших грибов Базидиомицетов получил свое название оленьи рожки. Существует еще несколько названий этого плода – рогатик, ежовик коралловидный, коралл и т.д.

Встретив рогатик в лесу, не каждый грибник осмелится его срезать. Это связано с довольно экзотическим внешним видом. Данный вид считается съедобным, и поэтому до занесения в Красную книгу его можно было собирать и готовить самыми разнообразными способами.

Характерные особенности сорта

Ботаническое название коралла – Рамария желтая, которая относится к семейству Рогатиковые. Форма рогатика напоминает ветвистые рога оленя или подводный коралл.

Описание оленьих рожек и фото гриба

На фото отлично видно, что наземная часть гриба оленьи рожки весьма ветвистая.

Его окрас зависит от некоторых факторов:

  • места обитания;
  • особенности климата;
  • возраста.

Ветви могут быть окрашены в бежевый, светло-коричневый, светло-желтый, оранжевый или лиловый цвет. В основном высота плодового тела не превышает 7 см, зато ширина варьируется от 15 до 30 см. При надавливании на плод появляется светло-коричневый оттенок. Рогатик в срезе имеет мраморно-желтый окрас. Гриб обладает приятным ароматом, который напоминает запах только что скошенной травы.

Морфология

Верхушки старых рогатиков накапливают вещества, которые придают ему горький вкус. Поэтому верхние ветви не используют в пищу. Сам гриб отличается вкусовыми качествами от своих сородичей, ведь у него нет ярко выраженного грибного вкуса. Сырые рогатики довольно упругие, а после приготовления становятся жестковатыми.

Очень похожи на золотисто-желтые рамарии ежовики. Отличия этих экземпляров можно заметить только под микроскопом. Ничего страшного не произошло бы, если срезать двойник, ведь обе рамарии являются съедобными.

Место распространения

Данный вид встречается крайне редко. Найти такое сокровище можно в регионах Дальнего Востока, Карелии, Кавказа, Западной и Восточной Сибири, а также в Крыму. Большинство жителей центральной части нашей страны даже не догадываются о существовании подобного «лесного хлеба».

Это связано с особенностями произрастания рогатиковых. Обитают они во влажных и затененных местах. Чаще всего найти их можно в сосновом или лиственном лесу, где вырастают наиболее ценные экземпляры.

Съедобный или несъедобный

Рогатиковые бывают как съедобные, так и несъедобные. В связи с этим следует внимательно изучить желтую рамарию, чтобы можно было ее отличить од других сородичей. Все двойники ежовика являются умеренно ядовитыми или условно съедобными, поэтому их употребление в пищу не может привести к летальному исходу.

Рамария желтая – съедобный гриб, но перед употреблением важно следовать некоторым мерам предосторожности. Для приготовления используют только основание, ведь веточки имеют горький привкус. Перезрелые плоды считаются непригодными из-за большого скопления горечи.

Когда и как правильно собирать?

При сборе следует быть крайне осторожным, ведь среди рогатиковых существует немало ядовитых двойников. Собирают и заготовляют съедобные кораллы с августа по сентябрь включительно. В этот период их можно отыскать в подлеске одиночными «кустиками» или группами из нескольких рогатиков. А в южной части страны их собирают даже в зимнее время.

Существует несколько правил, которых следует придерживаться при сборе желтой рамарии:

    Старые грибы не стоит срезать, ведь они имеют горький вкус. Собирают только молодые рогатики.

Как отличить от ложных, ядовитых грибов?

Важно помнить, что рогатики имеют достаточно много двойников, которые относятся к несъедобным или даже ядовитым представителям грибного мира. Первое, на что надо обратить внимание при сборе, это цвет кустика. В молодом возрасте грибы окрашены в молочный, бежевый или желтый цвет.

Старые экземпляры, которые считаются несъедобными из-за горечи, обладают ярко-оранжевым окрасом. Место среза становится мраморно-желтого оттенка, а при надавливании на плодовое тело образуется светло-коричневый оттенок. Запах гриба очень похож на аромат скошенной травы.

Рамария красивая является близкой родственницей рамарии желтой, поэтому они довольно похожи. В отличие от съедобного сородича, рамария красивая относится к ядовитым грибам. Отличить их довольно сложно, особенно начинающим грибникам. Иногда при надавливании на ядовитые плодовые тела на мякоти появляется красный оттенок.

Полезные свойства, ограничения и рецепты

Кроме отличных вкусовых качеств рогатик обладает некоторыми полезными свойствами. В его составе имеются аминокислоты, стерин, липиды и фитоагглютинин. Особенно популярен гриб в китайской медицине, где его используют для лечения нарушений работы ЖКТ и заболевания дыхательных путей. Употребление рогатиков способно укрепить иммунную систему.

Существует мнение, что данный вид обладает противоопухолевым эффектом. Молодые экземпляры используют и в косметологии, ведь его клетки способны замедлять процесс старения.

Употреблять» в пищу желтые кораллы следует небольшими порциями. Особых ограничений нет, кроме индивидуальных аллергических реакций. После сбора следует тщательно помыть рогатики, ведь между веток собирается много мусора.

Как и прочие сородичи, рогатики требуют варки около 30 минут. Их предварительно моют и нарезают мелкими кусочками. Из них можно приготовить соусы, салаты, начинку для выпечки и заготовить на зиму в маринованном виде.

Ингредиенты к салату

Для приготовления вкусного салата следует подготовить следующие ингредиенты:

  • 150 г вареных рогатиков;
  • 150 г свежей моркови;
  • одна средняя луковица;
  • 2 ст. л. столового уксуса;
  • 1 ст. л. растительного масла;
  • два зубчика чеснока;
  • специи и зелень по вкусу.

Грибы смешивают с морковью и мелко нарезанным чесноком. После этого заправляют подсолнечным маслом, добавляют соль и специи. Полученную смесь хорошо перемешивают и оставляют на 30 минут. В это время можно подготовить лук. Его нарезают тоненькими кольцами и маринуют в уксусе. Все ингредиенты смешивают и оставляют салат настояться несколько часов.

Салат из оленьих рожек

Очень вкусным получается суп. Для приготовления понадобятся такие продукты:

  • картофель;
  • морковь;
  • лук;
  • сливочное масло;
  • зубчик чеснока;
  • зелень и специи по вкусу;
  • 300-400 г грибов.

Рожки отваривают в отдельной посуде на протяжении 20 минут, после чего сливают на дуршлаг, чтобы вода хорошо стекла. Дальше приступают к готовке супа. В холодную воду добавляют картофель, морковь, лук и чеснок. После закипания в кастрюлю высыпают отваренные грибы и проваривают на слабом огне около 10 минут. Затем добавляют соль, специи и зелень. Получается легкий и вкусный грибной суп.

Ответы на распространенные вопросы

Нобычной формы грибы вызывают массу вопросов у грибников:

При сборе любых грибов следует строго соблюдать некоторые правила: урожай срезают, а не срывают с корнем; землю и мох в лесу не стоит сильно ворошить или перекапывать; собирать грибы в заповедниках запрещено; массовый сбор любого вида обязательно приведет к его вымиранию.

Резинистая мякоть калоцеры имеет красноватый оттенок. Вкус и запах у ложного гриба отсутствуют. Плодовое тело имеет заостренные веточки и окрашено в темно-желтый или оранжевый цвет. На калоцеру очень похожи настоящие желтые кораллы, для которых не характерна хрящевидная и студенистая консистенция плодового тела.

Коралловидный ежовик является одним из наиболее необычных представителей своего семейства. Он славится не только интересной формой, но и хорошими вкусовыми качествами. Но при сборе этого вида следует быть крайне осторожным, ведь его можно легко перепутать с ложными кораллами.

Данный вид любители тихой охоты ласково назвали «оленьи рожки» за поразительное сходство с этой частью тела животных. Их разветвленные плодовые тела также напоминают морские кораллы. Гриб относится к категории съедобных видов, имеет отличные вкусовые качества, его солят, маринуют, жарят и т. д. Узнайте, как и где можно встретить удивительные плоды в лесу, как их правильно определить и что вкусного приготовить из рогатиков.

Систематика, характеристики и описание строения

Рогатик жёлтый относится к виду Рамария жёлтая, род Рамария, семейству Гомфовые. Другие названия: Рамария жёлтая, Рогатик жёлтый, Медвежья лапка, Коралл жёлтый. Наименование на латыни — Ramaria flava.

Высота рогатика порой достигает 20 см. Таким же может быть и диаметр. Плодовое тело сильно разветвленное, состоит из мясистых, серно-желтых или лимонно-желтых ветвей. Позднее они меняют цвет на охристый или оранжевый. Верхушки веточек тупые, с неправильно усеченными концами.

Справка! Если надавить на плодовое тело рогатика, на этом месте образуется пятно винно-коричневого цвета.

Мякоть хрупкая, имеет водянистую консистенцию. Ее цвет светлый, желтоватый, запах — слабый, приятный, мучной, вкус невыразительный. По мере старения плодового тела становится горьковатой, особенно в веточках.

Ножка достигает 8 см в длину и 5 — в толщину. Окрашивается во все оттенки жёлтого в зависимости от цвета всего плода, ближе к основанию светлеет. Если надавить, становится красновато-коричневой.

Споровый порошок белый, сами споры образуются на внешней поверхности гриба.

Немного истории

Данный вид был впервые описан ученым Жозефом де Турнефором, французским ботаником, в 1755 году. Биномиальное имя рамария желтая получила благодаря Люсьену Келе, основателю Французского микологического общества, в 1888 году.

Время и место плодоношения

Медвежья лапка предпочитает зоны с умеренным климатом. Селится на почве в хвойных, лиственных и смешанных лесах. Произрастает поодиночке или небольшими группами. Рогатика жёлтого можно встретить в горах Кавказа, Карелии, в странах Центральной Европы (России, Крыму, Беларуси).

Время плодношения август — сентябрь. Занесен в Красную книгу как редчайший вид и считается высшим грибом.

Важно! Более взрослый экземпляр рамарии жёлтой начинает горчить, поэтому опытные любители тихой охоты рекомендуют собирать рогатики в молодом возрасте, т. е. в начале августа-сентября.

Видео

Выращивание в домашних условиях и на даче

Культивирование рогатика жёлтого не целесообразно, так как гриб довольно прихотлив в уходе. Среди садоводов подобное выращивание не практикуется. Ввиду того, что этот вид занесен в Красную книгу, есть сведения, что культивированием рамарии желтой занимаются в промышленных масштабах, разводя вид искусственно.

Ложные двойники

Медвежью лапку можно спутать со схожими видами, которые не всегда являются съедобными. Поэтому есть смысл внимательно изучить особенности гриба на фото и посмотреть на таблицу, чтобы не спутывать опасные виды с безобидным рогатиком:

Справка! Слово flava в названии гриба означает «желтый».

Лечебные свойства и использование гриба в медицине

Рамария желтая содержит полезные аминокислоты метионин и триптофан, липиды, фитоагглютинин и стерин. Последний часто применяют китайские врачеватели для исцеления от проблем с ЖКТ, а также, чтобы улучшить работу легких.

Считается, что рогатик жёлтый обладает и противоопухолевым свойством, укрепляет иммунную систему. Кроме того, гриб оленьи рожки применяют в косметологии для замедления процессов старения, при увядании кожи.

В народной медицине из медвежьей лапки делают настои для лечения суставов, целебные отвары для избавления от гельминтов и паразитов.

Оценка вкусовых качеств, химический состав, польза и возможный вред

Несмотря на то что оленьи рожки относят к грибам четвертой категории из-за присутствия в процессе роста характерной горечи, в молодом виде они достаточно вкусны и их можно готовить так же, как и большинство других съедобных видов.

Химический состав на 100 граммов гриба:

  • 2 г белка;
  • около 4,5 г жиров;
  • почти 3 г углеводов.

Средние показатели калорийности – 55 ккал на 100 г.

Польза рамарии желтой заключается в следующих качествах:

  1. Предупреждение появления злокачественных новообразований.
  2. Снятие депрессивных состояний и нормализация психического состояния.
  3. Укрепление сосудов, стабилизация работы сердечно-сосудистой системы.
  4. Избавление от заболеваний бронхолегочной системы, органов дыхания.
  5. Профилактика тромбоза, нормализация кровяного давления.
  6. Повышение иммунитета.
  7. Очищение организма, выведение токсинов и продуктов распада.

Основная сфера применения желтых кораллов в косметологии — омолаживающие процедуры. Оленьи рожки обладают способностью задерживать влагу в эпителиальных слоях, их эффективность в разы превышает свойства глицерина и гиалуроновой кислоты. Содержащиеся в химическом составе природные полисахариды выступают проводниками полезных веществ к глубоким слоям кожи, а витамин D активизирует метаболические процессы.

Возможный вред от употребления также присутствует. Как и любой другой вид грибов, желтые рогатики запрещено есть детям до 12 лет, беременным и кормящим женщинам, людям с хроническими заболеваниями органов желудочно-кишечного тракта и склонностью к аллергическим проявлениям.

Рецепты приготовления блюд из оленьих рожек

Широкое практическое применение грибных кораллов в кулинарии обусловлено их низкой калорийностью и быстрой усвояемостью. Блюда из них рекомендуют диетологи тем, кто хочет сбросить лишний вес и одновременно укрепить здоровье. Спектр рецептов и способов обширен: рамарию желтую можно жарить, варить, замариновывать, засолить, приготавливать жаркое, пожарить с овощами или картошкой, консервировать, готовить в соленом виде, варить супчик, делать заготовки в виде икры.

Первичная обработка в домашних условиях

Чтобы гарантировать отсутствие горечи, рамарию желтую предварительно отваривают 15–20 минут, сливая отвар либо удаляют концы веточек. Обработанные таким образом лесные «кораллы» можно готовить, как и прочие съедобные грибы — варить до полной готовности, жарить и тушить, мариновать и солить.

Интересно! Истинные ценители грибов знают, что молодые оленьи рожки неповторимы в блюдах. В зависимости от способа приготовления, они могут напоминать нежную куриную грудку или мясо креветок.

Варка

Оленьи рожки нужно промыть и замочить в большом объеме холодной воды на 1 час. Затем отожмите плодовое тело и промойте еще раз. Срежьте ножом твердые части ножек. Поместите плод в кастрюлю с кипящей подсоленной водой и варите примерно 10–12 минут. Откиньте грибы на дуршлаг после отваривания, дайте стечь лишней жидкости. Нарежьте тонкими полосками или другим способом, которого требует рецепт, и продолжайте готовить далее.

Маринование

Некоторые любители тихой охоты не очень жалуют маринованные оленьи рожки и совершенно напрасно. Этот красивый гриб в банке напоминает настоящий коралл. Зимой замаринованная рамария желтая будет очень кстати, она способна украсить любой стол!

Ингредиенты:

  • рогатики – 1 кг;
  • соль – 1 ст. л.;
  • сахар – 1 ст. л.;
  • уксус – 1 ч. л.;
  • специи: гвоздика, лавровый лист, перцы.
  1. Проведите предварительную подготовку: замочите и отварите грибы на протяжении 10 минут.
  2. В глубокой емкости приготовьте маринад: разведите в 1 л воды специи, приправы, уксус.
  3. Поместите в кастрюлю грибы, отваривайте в течение 30 минут.
  4. Замаринованные рогатики уложите в чистые, стерилизованные банки, залейте кипящим рассолом.
  5. Укупорьте пластиковыми крышками, отправьте на хранение в прохладное место.

Справка! Из-за особенностей строения оленьи рожки считаются одними из самых грязных грибов. Мыть их следует минимум 3 раза в проточной воде.

Жарка

Приготовлять жёлтые рогатики в жареном виде совсем несложно. Это делается по аналогии со способами готовки других грибов. Добавьте в конце по вкусу сливки или сметану, рубленую зелень или чеснок — блюдо заиграет новыми красками.

Ингредиенты:

  • рамария м 500 г;
  • масло растительное – 2 ст .л.;
  • соль – по вкусу;
  • лук – 1 головка;
  • черный молотый перец — щепотка.

Как готовить грибы оленьи рожки:

  1. Тщательно промойте и предварительно отварите плодовые тела в подсоленной воде на протяжении 10 минут.
  2. Слегка отожмите, сцедите лишнюю жидкость.
  3. Луковицу очистите, порубите мелкими кубиками, обжарьте на масле до мягкости.
  4. Нарежьте медвежьи лапки соломкой или кубиками. Поместите в сковороду к луку.
  5. Готовьте под закрытой крышкой 10–15 минут, приправьте солью и специями.

Способ засолки

Любители тихой охоты настоятельно не рекомендуют при засаливании желтых рогатиков добавлять специи и ароматные травы, считая, что это только уничтожит прекрасный запах и вкус рамарии.

Компоненты:

Как засолить медвежьи лапки:

  1. Перед засаливанием не нужно мыть плодовые тела, иначе они напитаются влагой и раскиснут. Почистите рамарии аккуратно при помощи щетки, чтобы убрать мусор, листья с веточек.
  2. Поместите грибы слоями в подходящую емкость, пересыпая каждый солью.
  3. Прикройте ведро или кастрюлю чистой марлей, сверху расположите увесистый гнет.
  4. Храните заготовку в холодном месте. Через 30 дней грибочки можно уже попробовать.

Сушка

Молодые плоды рамарии желтой можно сушить. Перезрелые плодовые тела иногда подгнивают при высушивании, а молодые легко высыхают. Для засушивания их нужно разделить на максимально возможное число веточек, оставив при этом часть ножки. Через нее будет продеваться нить, к тому же, так они надежнее будут закреплены. Далее грибные гирлянды вывешиваются в тени в сухом и проветриваемом помещении.

Справка! При приготовлении блюд из засушенных оленьих рожек гриб необходимо на 12 часов замочить в воде, а потом тщательно промыть и 10 минут проварить.

Суп из рамарии

Для приготовления вкусного, наваристого супчика не нужно искать дорогие компоненты, всё необходимое есть всегда под рукой. Подайте вкусное первое угощение с гренками из черного ржаного хлеба.

Ингредиенты:

  • рогатики – 400 г;
  • лук – 1 головка;
  • морковь – 2 шт.;
  • картофель – 3 клубня;
  • сливочное масло – 30 г;
  • чеснок – 2 зубка;
  • зелень укропа, соль – по вкусу.
  1. Отварите предварительно замоченные плодовые тела рамарии в подсоленной воде в течение 20 минут. Жидкость слейте и больше не используйте. Некоторые хозяйки утверждают, что можно и 2 раза проварить рогатиков, будет только лучше.
  2. Очистите овощи, нарежьте их мелкими кубиками. Морковь, при желании, можно измельчить с помощью терки.
  3. Поместите все овощи в большую емкость, залейте кипящей водой, готовьте 10–15 минут на среднем огне.
  4. Добавьте грибы, которые можно предварительно нарезать тонкими полосками.
  5. Варите суп еще 10 минут.
  6. Выключите огонь, добавьте сливочное масло, давленый чеснок, рубленую зелень. Приправьте специями и солью.

Консервирование на зиму в банки

Попробуйте приготовить очень вкусное овощное ассорти с грибами оленьи рожки. Такое блюдо по праву можно назвать деликатесом, а область его применения очень обширна: закуска, гарнир, дополнение к пасте, картошке.

Ингредиенты:

  • рамария желтая – 1 кг;
  • кабачки – 700 г;
  • баклажаны – 2 – 3 шт.;
  • перец – полкилограмма;
  • морковь – 2 шт.;
  • сладкий перец – полкилограмма;
  • лук – 2 шт.;
  • мускатный орех — щепотка;
  • подсолнечное масло – 150 мл;
  • соль – 1 с т. л.;
  • яблочный уксус – 50 мл.
  1. Отварите рогатиков дважды в подсоленной воде. Каждый раз сливайте отвар и заливайте холодной водой.
  2. Очистите все овощи. Лук порежьте кубиками, остальные плоды – покрупнее.
  3. Обжарьте в половине порции масла грибы с луком.
  4. На оставшемся масле пожарьте остальные овощи.
  5. Смешайте все компоненты в глубокой емкости.
  6. Добавьте соль и мускатный орех, влейте яблочный уксус.
  7. Разложите заготовку по чистым банкам, прикройте крышками.
  8. Стерилизуйте каждую банку на протяжении 10 минут в медленно кипящей воде. Закатайте, отправьте в прохладное место.

Правила хранения и заморозка

Чтобы сохранить на зимний период рогатиков практически в первозданном виде, можно их заморозить. Но перед тем как отправлять грибы в морозилку, их также нужно подвергнуть предварительной подготовке: вымочить, отварить в двух водах с солью. Затем плодовые тела откидывают на дуршлаг, дают стечь воде и раскладывают порционно по емкостям. Каждый контейнер помещают в морозильный отсек и используют по мере надобности.

Интересные факты

Считается, что самые вкусные оленьи рожки — только собранные. Их можно отварить, а затем добавить к основному блюду.

Из-за специфической горечи некоторые считают гриб ядовитым, но это не так. Правильно приготовленные оленьи рожки весьма необычны, но безвредны и вкусны. Они принадлежат к четвертой категории грибов.

Не стоит собирать рамарии желтые вдоль дорог и в прочих загрязненных местах, где они накапливают большое количество токсичных веществ.

Гриб рогатик жёлтый чрезвычайно похож на золотисто-жёлтый коралл, причем отличить один вид от другого можно только под микроскопом.

Красиво ветвящиеся плодовые тела рогатиков жёлтых очень привлекают грибников своим внешним видом, напоминающим морской коралл. Эти полезные плодовые тела нашли широкое применение в медицине, косметологии. Не нужно набирать полные корзины этого редкого гриба, но полакомиться небольшим количеством непременно стоит.

>

Оленьи рожки съедобные (75 фото) » НА ДАЧЕ ФОТО

Оленьи рожки Ramaria Flava


Оленьи рожки грибы Рамария


Оленьи рожки Ramaria Flava


Гриб древесный похожий на рога оленя


Гриб Рамария желтая


Гриб Рамария желтая


Ежевик Оленьи рожки


Жарят ли Оленьи рожки


Рогатик рожковидный


Крымские грибы Оленьи рожки в Крыму


Ежовик, Оленьи рожки.


Рамария гроздевидная


Оленьи рожки грибы в Крыму


Оленьи рожки грибы маринованные


Гриб Оленья губа


Калоцера клейкая Оленьи рожки


Рамария большеногая


Гриб Рогатик Рамария


Гриб Рогатик коралловидный


Калоцера клейкая Оленьи рожки


Крымские грибы Оленьи рожки в Крыму


Рамария золотистая


Коралловый Рогатик гриб


Грибы Рамария золотистая


Гриб Рогатик белый


Оленьи рожки для начинки пельменей


Грибы Оленьи рожки съедобные и ложные


Ежовик, Оленьи рожки.


Гриб Рамария желтая


Оленьи рожки Ramaria Flava


Оленьи рожки грибы Рамария


Гриб Рогатик желтый


Гриб Калоцера клейкая съедобный


Рогатик прямой


Рамария желтая


Калоцера клейкая Оленьи рожки


Оленьи рожки грибы


Clavulina жёлтая и Калоцера клейкая


Трутовик гриб Оленьи рожки


Калоцера клейкая


Оленьи рожки грибы


Рогатик коралловидный


Гриб Оленья губа


Рамария Флава


Рамария Оленьи рожки


Ежовик, Оленьи рожки.


Рамария золотистая — Ramaria Aurea


Оленьи рожки грибы сушеные


Олений гриб


Рогатик Оленьи рожки


Рогатик Оленьи рожки


Рогатик фиолетовый


Калоцера гриб


Гриб Оленьи рога съедобный


Гриб Рогатик палевый


Трутовик гриб Оленьи рожки


Садовый цветок похожий на Оленьи рожки в инее


Оленьи рожки грибы


Оленьи рожки Ramaria Flava


Гриб похож на Оленьи рога белый


Рогатик Оленьи рожки


Гриб Оленьи рожки в Приморье


Кораллообразные грибы


Рамария гриб


Оленьи рожки грибы


Гриб Оленьи рожки в Приморье


Гриб Рогач


Грибы бараньи рожки


Гриб Рогатик желтый


Рогатик Оленьи рожки


Калоцера клейкая Calocera viscosa


Гриб Клавикорона коробчатая


Рогатик Оленьи рожки


Гриб Рогатик Рамария


Ежевик Оленьи рожки

Грибы Оленьи рожки съедобные (73 фото) » НА ДАЧЕ ФОТО

Оленьи рожки грибы в Крыму



Рамария Оленьи рожки


Гриб Олений язык


Ramaria Aurea


Оленьи рожки грибы



Гриб Оленьи рога


Краснодарский край гриб Оленьи рожки


Рогатик гроздевидный (Ramaria Botrytis


Клавикорона крыночковидная


Гриб Рогатик белый


Оленьи рожки грибы Рамария


Рамария желтая


Рамария большеногая


Калоцера клейкая Оленьи рожки


Гриб похожий на кружево


Оленьи рожки грибы


Ramaria Botrytis


Грибы Оленьи рожки съедобные


Оленьи рожки грибы Рамария


Гриб Оленьи рога


Рамария гриб Ramaria Flava


Калоцера клейкая Calocera viscosa


Гриб Оленьи родки не съедобные


Грибы Оленьи рожки фиолетовые


Коралловый Рогатик гриб


Коралловый Рогатик гриб


Оленьи рожки грибы


Гриб Рогатик аметистовый


Рамария гроздевидная


Грибы Оленьи рожки съедобные и ложные


Рамария Флава


Гриб Рогатик аметистовый


Рогатик Оленьи рожки


Рогатик фиолетовый


Крымские грибы Оленьи рожки в Крыму


Калоцера гриб


Ежовик, Оленьи рожки.


Гриб Рамария съедобный


Коралловый Рогатик гриб


Оленья губа гриб фото


Пурпурный Оленьи рожки


Рамария красноватая


Оленьи рожки грибы


Гриб Рогатик желтый


Калоцера клейкая


Рогатик желтый Рамария желтая


Гриб Рогатик желтый


Рамария и Клавикорона


Оленьи рожки Ramaria Flava


Clavulina amethystina


Рогатик Оленьи рожки


Грибы Оленьи рожки несъедобные


Гриб Олений мох


Гриб Оленья губа


Гриб Рогатик желтый


Гриб Рамария желтая


Оленьи рожки грибы


Гриб Оленьи рога


Калоцера клейкая


Рамария гриб Ramaria Flava


Лже Оленьи рожки грибы


Рамария Оленьи рожки


Гриб Рогатик


Гриб Рамария желтая


Рамария финская


Гриб Рогатик палевый


Гриб Рамария желтая


Крымские грибы съедобные Оленьи рожки


Оленьи рожки грибы в Крыму


Грибы ежовик и Рогатик


Ежевик Оленьи рожки

Калоцера клейкая (он же — рогатник или оленьи ножки): фото гриба рогатика и применение

Калоцера клейкая (Calocera viscosa) относится к условно-съедобным грибам, то есть, их можно употреблять в пищу только после специальной предварительной обработки. Часто калоцеру называют рогатником или рогатиком благодаря ярко выраженным «рожкам».

Семейство: Дакримицетные (Dacrymycetaceae).

Описание. Плодовое тело высотой от 2 до 8 см, кустистое, слаборазветвленное. «Оленьи рожки» грибов рогатиков немного клейкообразные, как будто светящиеся изнутри. Мякоть калоцеры упруго-студенистая, резинистая, красноватая, без особого вкуса и запаха.

Плодоносит гриб рогатик с начала июля до октября, на погруженной или погребенной в почве гнилой древесине хвойных пород (обычно сильно врастает в субстрат), в хвойных и смешанных лесах, одиночно и группами. Встречается часто по всей лесной зоне России.

Обратите внимание на фото гриба рогатика: плодовое тело с заостренными кончиками веточек имеет темно-желтый или оранжевый окрас и весьма замысловатую форму.

Сходные виды. На калоцеру похожи многие настоящие желто-окрашенные рогатики, но ни для кого из них не свойственна характерная хрящевидно-студенисто-резинистая консистенция калоцеры.

Рогатник: лечебные свойства и другие факты

Лечебные свойства: Выделенные из мицелиальной культуры полисахариды останавливают рост саркомы-180 и карциномы Эрлиха на 90 %. Гриб содержит 5-гидрокситриптофан, прекурсор серотонина и мелатонина.

Правила сбора и заготовки: Собирают свежие плодовые тела, не начавшие засыхать или коричневеть. Используются спиртовые настои.

Интересные факты. Несмотря на очевидное сходство с рогатиками, этот гриб не имеет к ним никакого отношения. Он относится к дрожалковым грибам, его родственники — дрожалки, ложноежовик студенистый, аурикулярия и другие студенистые гетеробазидиальные грибы.

Съедобные или нет грибы рогатики (оленьи ножки)?

О том, съедобный гриб рогатик или нет, существует однозначный ответ – калоцеру есть можно, вреда она не принесет, но вкусовые качества её весьма сомнительны. Многие кулинары считают эти качества весьма низкими из-за резинистой мякоти калоцеры. В пищевых целях рогатник собирается крайне редко, употребляется варены, жареным и сушеным.

Применение в кулинарии: В Болгарии съедобный гриб рогатик из-за красивого цвета используют в отварном виде как украшение в холодных закусках. Кроме того клейкую калоцеру добавляют в холодец перед его застыванием.


Скрипница гриб почти как груздь, только полезнее

Не всякий грибной охотник знает, что у «грибного царя» есть двойники, которые по вкусовым свойствам и пользе для организма не уступает, а иногда даже обгоняют величественные грузди. Качественная обработка позволяет достичь. Скрипица, или войлочный гриб, как раз является ярким представителем полезных двойников.

Скрипница гриб почти как груздь, только полезнее

Биологическая характеристика гриба, и история появления названия
  • Относится к царству грибов
  • Принадлежит базидиомицетам
  • Класса агарикомицетов
  • Сыроежкового порядка
  • Семейства сыроежковых
  • В роде млечников

Другие названия: скрипач, подсухарь, груздь молочайный, молочный подскрёбыш, молочай, скрипица, осиновый скрипун, скрипуха.

Скрипница гриб почти как груздь, только полезнее

Свои названия этот гриб получил, из-за необычного умения скрипеть, когда с ним соприкасаются шляпки других груздей скрипачей. Скрипухи так же выдают отличительные для своего вида скрипы и выделяют млечного оттенка едкий сок, когда их режут ножом.

Немного истории

Первые упоминания о подскрёбыше были сделаны в книге Observationes Mycologicae, автором которой является ботаник-миколог Персен Христиан Генрих. Род лактариусов(млечники), к которому относится скрипица, был открыт в 1797 году в составе ещё шести видов.

Внешние характеристики и описание гриба

Своеобразный вкус и запах имеет мясистое тело. Так же гриб скрипица съедобный имеет следующие отличительные особенности:

Шляпка
  • Структура мясистая, суховатая, с войлочной поверхностью, скрипит при соприкосновении с другими предметами
  • Диаметр шляпки изменяется в течении созревания гриба от 5 до 26 см
  • В периоде взросления форма шляпки меняется с плоской, либо немного выпирающей к центру с низкими бортами, до воронкообразной с растрескавшимися краями
  • Цвет меняет свою палитру с молочного, на более насыщенный с оттенком охра и вкраплением желтых пятен

Гименофор (нижняя часть мясистого тела)
  • Имеет пластичный вид
  • Редкие пластинки шириной 3-8 мм расположены по площади гимения и имеют зеленовато-кремовый оттенок, в дальнейшем свисающие на ножку гриба. С возрастом приобретают желтоватый оттенок
  • Спорный материал шиповидный, белого тона
Скрипница гриб почти как груздь, только полезнее

Мякоть
  • Горькая по вкусу, жёсткая, ломкая и легко крошится при надавливании
  • Млечный сок выделяется. Вступая в реакцию с воздухом, приобретает жёлтый цвет, а когда высыхает, то становится красновато-коричневым

Ножка
  • Прямая, без изгибов, сужается к шляпке
  • Поверхность войлочная, ярко белая
  • Достигает длинны в 6-6,5 сантиметров с толщиной не более 4-х см
  • Плотная структура мякоти
Скрипница гриб почти как груздь, только полезнее

Сезон плодоношения и веста, где можно «охотиться»

Западная Европа, дальний восток и почти вся территория Российской Федерации может являться местом урожая молочая.

Хвойный, лиственный и смешанный лес может являться ареалом его обитания при этих условиях:

  • Большое количество солнечных лучей
  • Берёзы и осины в большом количестве, рядом с которыми грибу больше нравится расти
  • Старые, перепревшие листья и мох, покрывающие почву

Можно ли вырастить дома или на даче?
Можно!

При условии, что у вас есть достаточное количество мицелия этот процесс не вызовет у вас особых сложностей.

Алгоритмы действий и необходимые компоненты для успешного выращивания грибов, как для себя, так и на продажу:

Простой рецепт для тех, кто не смог найти готовый мицелий для выращивания

  1. Найти и собрать в лесу сильно перезревшие грибы
  2. Разломать на мелкие кусочки
  3. После смешать с опилками и торфом
  4. Удобрить питательным раствором
  5. Найти крышку с маленькими отверстиями и накрыть ей
  6. В предварительно нагреть помещение до 23-х градусов Цельсия
  7. Оставить приблизительно на трое суток в таких условиях
  8. Непосредственно перед посадкой взять раствор извести и обработать им почву(на 10 литров воды пятьдесят грамм извести)
  9. Рядом с лиственным деревом предварительно подготовить углубления
  10. Наполовину заполнить углубление субстратом, который ранее приготовили
  11. Присыпать подготовленным ранее грунтом с известью
  12. Укрыть мхом, положив сверху прелую листву

Рецепт с мецелием, для тех, кто всё-таки смог его раздобыть =)

  1. Подготовить достаточное количество опилок лиственной древесины и лесного грунта
  2. Смешать землю и опилки с мицелием
  3. В лесу, где прорастает скрипач, собрать мох и прелую листву
  4. В периоды с конца весны до начала осени сделать высевку грибницы скрипунов
  5. Приготовить питательный раствор для подкормки из пищевых дрожжей и сахара
  6. Подкармливать хотя бы раз в 3 дня

Урожай после посева можно собирать примерно в течение пяти лет, с учетом использования мицелия можно так же попробовать вырастить гриб скрипицу в подвале, гараже или сарае.

Есть ли у скрипуна ложные близнецы?

Есть, но смертельно ядовитых братьев – нет. Они все условно-съедобные. Вот список:

  • Подгрузок белый
  • Груздь перечный
  • Груздь настоящий(белый)

Распознать подделки можно в первую очередь по шляпке. Больше всех похожую шляпку имеет только груздь настоящий, у него она тоже пушистая, но не скрипит при соприкосновении с другими предметами и намного сильнее покрыта «войлоком».

Так же все они имеют разные по свойствам млечные соки. Подгрузок белый, например, вообще его не имеет, но все остальные, так же как и скрипач на вкус горьковатые. Меняется в основном цвет млечного сока, сок скрипицы при соприкосновении с воздухом начинает слегка желтеть и краснеет при засыхании.

Ножка у груздя настоящего и подгрузка становится с возрастом полой, а у скрипицы цельная, как и у перечного груздя. Но, их всегда можно опознать по шляпке, которая у последнего гладкая, а не ворсистая.

По пластинкам скрипицу можно сразу отличить от подгрузка и перечного груздя, но с груздём белым они схожи по частоте и толщине. Как их отличить друг от друга по другим признакам вы легко найдёте и разберётесь сами, прочитав три предыдущих абзаца.

Полезные свойства и возможный вред скрипуна

Ученые диетологи не рекомендуют употреблять этот гриб в сыром виде, так как он содержит микроэлементы, которые раздражают желудочно-кишечный тракт и вызывают рвоту. Горький привкус у свежей скрипицы не устраняется и после термической обработки.

Однако, должная обработка убивает все болезнетворные вещества в грибе и приносит в одной порции этого блюда весь перечень полезных веществ для организма: железо, фосфор, калий, натрий. Так же гриб легко можно назвать диетическим за низкое содержание килокалорий, на 100 грамм всего 22 ккал.

При частом употреблении груздь войлочный позитивно влияет на такие процессы организма как:

  • Повышение уровня общего иммунитета организма
  • Улучшает общее самочувствие
  • Нормализует сахар и холестерин в крови человека
  • Восстанавливается энергетический баланс
  • Способствует становлению иммунитета к бактериальным и вирусным заболеваниям

Народ Китая, например, использует этот в профилактике и устранении болей в сухожилиях, конечностях таза и суставах.

Но есть и некоторые противопоказания перед применением:

  • Подагра
  • Период лактации и беременность
  • Различные аллергии
  • Больные почки и печень
  • Различные заболевания ЖКТ

Не советуют его кушать и детям в возрасте до 12 лет из-за повышенного содержания соли и тяжести переваривания.

Первичная обработка и рецепты по приготовлению скрипунов

Перед приготовлением грибов в еду грибы стоит их очистить от млечного сока нехитрым алгоритмом действий:

  • Разобрать от червивых или некачественных
  • Убрать с них грязь, мох и лишние листья
  • Вымачивать

Для правильного вымачивания есть 2 способа:

  1. На 5-7 дней помещать грибы в подсолённую воду, периодически меняя её на свежую.
  2. Быстрый метод – заливать грибы кипятком, меняя его примерно 5 раз за сутки.
Варить гриб нельзя! Горечь всё равно останется, поэтому едят его только засоленным.

Вот рецепт:

По холодному:
  1. Шляпками вниз уложить скрипухи в деревянную тару, сдабривая специями и солью каждый следующий слой
  2. Накрыть сверху тарелкой керамической, поставив сверху груз
  3. Подождать пока жидкость выделится и накроет грибы целиком. Если не выделяется жидкость, то долить подсолённой воды в соотношении 1л воды на 20 грамм соли
  4. Простерилизовать банки и уложить скрипухи вниз шляпками
  5. Последним слоем накрыть всё это листьями смородины иливишни
  6. Закатать крышкой и убрать на полтора месяца минимум
Скрипница гриб почти как груздь, только полезнее

По горячему:
  1. Наполнить эмалированную посуду солью (примерно 30 грамм)
  2. Взять вымоченные предварительно грибы скрипицы и ошпаривать в течении 25 минут, снимая при этом постоянно пену.
  3. Слить воду через дуршлаг и дать им остыть
  4. На дно стеклянной банки выложить листья смородины, добавить лаврушку и специи
  5. Затем уложить срипухи шляпками вниз, посыпая солью каждый слой
  6. Последним слоем вновь укрыть листьями смородины и убрать в холодильник солиться минимум на полтора месяца
Для справки! Листья смородины можно заменить на листья вишни, они нужны для предотвращения процессов образований плесени в банках.

Ложные сморчки — Большой сморчок

Понимание и идентификация ложного сморчка


Хотя веб-сайт The Great Morel предназначен для приятного времяпрепровождения и не предназначен для использования в качестве страницы идентификации грибов, эта страница является исключением. «Ложный сморчок» — самый запутанный и часто ошибочно идентифицируемый вид семейства сморчков, и эта страница предназначена для того, чтобы помочь лучше понять этот уродливый гриб. К приведенной ниже информации следует относиться со всей серьезностью.Эта страница не является попыткой изучить ложный сморчок с научной точки зрения, но дает вам общее представление и помогает раскрыть его уникальную сущность и характеристики. Вы можете найти ссылки внизу страницы, которые направят вас к другим исследовательским работам, которые глубже исследуют биологический состав этих грибов.

У «ложного сморчка» есть несколько видов, которые носят научные названия, такие как Gyromitra esculenta, Verpa, Hellvella и Disciotis. Виды Verpa и гиромитрина являются наиболее часто ошибочно идентифицируемыми разновидностями. Гиомитрин часто называют «красным грибом», «грибом бифштекс» или «лорчелом». Есть несколько истинных видов ложного сморчка, и хотя некоторые говорят, что могут без проблем приготовить и съесть ложный сморчок, у других есть резко противоположная реакция на них. Следовательно, Большой Морель предлагает вам не пытаться переваривать именно этот гриб.

Исследования показывают, что этот вид семейства сморчков содержит токсичное химическое вещество под названием Гиромитрин , токсичное и возможное канцерогенное вещество.В Интернете есть официальные документы, в которых предполагается, что это химическое вещество можно удалить из сморчков путем многократного кипячения небольших нарезанных кусочков в воде. Есть также шрумеры, которые скажут вам, что у них нет побочных эффектов от приема правильно приготовленных ложных сморчков, но есть свидетельства того, что даже небольшое количество неправильно обработанных ложных сморчков может иметь серьезные побочные эффекты. Даже приготовление ложного сморчка само по себе может быть опасным и может вызвать побочные реакции, поэтому избегайте вдыхания паров и паров.Исследования также показывают, что по всему миру растут различные виды ложных сморчков, и хотя некоторые из них могут быть не такими токсичными, как другие, разумно понять это и провести собственное исследование с умом.

Некоторыми из известных побочных эффектов являются тяжелые случаи диареи, сильные головные боли, рвота, тошнота, сильное головокружение и ДА, даже возможная смерть. Большой Морель настоятельно рекомендует оставить ложный сморчок именно там, где вы его нашли. Большой сморчок также предлагает (как и многие другие), что даже если у вас нет реакции, не предлагать ложный сморчок кому-либо еще, особенно детям и беременным женщинам.

Сказав это о биологическом составе ложного сморчка, давайте рассмотрим и обсудим некоторые визуальные характеристики. Имейте в виду, как указано выше, существует несколько видов ложных сморчков, и на этой странице показаны только несколько разновидностей. Когда вы смотрите на изображения ниже, вы можете нажимать на миниатюры, чтобы просмотреть увеличенное изображение. Обратите особое внимание на физические характеристики, которые будут обсуждаться. Некоторые из этих характеристик важны, чтобы помочь вам определить, действительно ли вы нашли ложный сморчок.

Давайте начнем с некоторых основных характеристик, которые сразу должны вас подсказать. Примечательно то, насколько уродливыми они могут казаться, как видно на картинке выше. Текстура или состав кепки или головы, как правило, могут иметь черты мозга, со складками на кепках, которые некоторые могут описать как морщины, и часто бывают хрупкими на ощупь. Цвет будет красноватым или коричневато-красным, а по мере старения ложных сморчков он станет почти черновато-красным.Вы можете увидеть, как это потемнение начинает происходить на изображении ниже. Размеры могут варьироваться от 2 дюймов до 10 дюймов.

Один из самых простых способов определить ложный сморчок — длинно его надрезать. Посмотрите на изображение ниже поперечного сечения и обратите внимание на мясистую текстуру стебля. Ложные сморчки не полые, и это самый верный признак того, что вы наткнулись на одного из этих уродливых плохих парней. Ложный сморчок, показанный на этом изображении, также довольно тяжелый, поскольку у него почти твердый стебель и мясистый, и его часто называют «хлопчатобумажным».Некоторые специалисты-микологи более подробно определяют взаимосвязь шляпки и стебля. По ссылкам ниже вы найдете больше фотографий и подробное описание физических отношений между колпачком или головкой и стержнем.

Теперь, если вы посмотрите на два изображения ниже, покажите, как выглядит съедобный сморчок, когда его нарезают. На первом изображен маленький желтый (кремовый) сморчок, а на втором — то, что называется серым сморчком. Найдите минутку и сравните это с изображением выше, вы увидите заметную разницу как в стержне, так и в том, как колпачок прикреплен к стержню.Стебель желто-серого сморчка полый. Вы можете просмотреть изображения всех съедобных сморчков на странице изображений сортов, щелкнув здесь , так как на нем показаны изображения съедобных сортов.



<

Эта дополнительная информация поступает от Learn Your Land , у которого есть YouTube страница , на которой показаны грибы, растения, деревья и животные на плато Аллегейни в Западной Пенсильвании. Он добавляет это при обсуждении изображения ниже: «… этот гриб не слишком часто попадает в Западную Пенсильванию….хотя в таком случае фотография обязательно обязательна. Gyromitra caroliniana — более южный вид, которого часто называют ложным сморчком. Интересный термин, как этот гриб, и настоящий сморчок, могут быть разными, как день и ночь. Ладно, не во всех отношениях, хотя вы вряд ли увидите настоящего сморчка таким большим и мускулистым. Вы также можете разрезать оба гриба пополам и заметить, что гриб Gyromitra имеет камеры, а настоящий сморчок полый сверху вниз. Существует множество видов Gyromitra, а также множество видов сморчков (морчелл).Выучите их все, и я обещаю вам жизнь без скуки.

Фотография любезно предоставлена ​​организацией Learn Your Land

Большой Морель понимает важность идентификации ваших сморчков и очень серьезно относится к идентификации, поэтому рекомендуется также посетить приведенные ниже ссылки на несколько замечательных сайтов и официальных документов, а также другие изображения различных разновидностей. ложных сморчков. Это очень информативные сайты, и Великий Морел всегда предлагает соблюдать осторожность даже после просмотра этих сайтов.

  • Еще изображения ложных сморчков из Большого сморчка. Если вы еще не посещали эту страницу, то это отличный источник дополнительных изображений, которые помогут вам идентифицировать этот уродливый гриб.
  • Tom Volk’s Fungus — Tom’s собрал эту замечательную страницу, посвященную Ложному Морелю. Великолепные изображения и еще более качественные данные.
  • Mushroom-Expert.Com — недавно созданный проект, получивший название «Проект ложного мореля: исследования в Гиромитре, Дисциотисе, Верпе и Гельвелле».«Если кто-то ищет в сети один из лучших сайтов по идентификации грибов, то это он!
  • Spring Morels and False Morels of Midcontinental US — фантастический технический документ Дональда М. Хаффмана и Лоис Х. Тиффани по идентификации сморчков.
  • Департамент охраны окружающей среды штата Миссури (Интернет) Съедобные и ядовитые ГРИБЫ Страница — отличный источник информации по определению хорошего, плохого и уродливого.
  • MykoWeb — Gyromitra esculenta — MykoWeb, страницы, посвященные науке о микологии (изучение грибов) и хобби грибоводства (погоня за грибами), содержат отличные изображения и данные о ложном сморчке.
  • Сайт архива северных рецептов содержит рецепты от традиционных финских, скандинавских и русских семейных блюд до популярных блюд интернациональной кухни. В нем также содержится рецепт приготовления финской ложной сморчки. Обратите внимание на примечание на этой странице, что «эти инструкции применимы только к ложным сморчкам, выращиваемым и продаваемым в Финляндии, и не применяются к ложным сморчкам, растущим в других странах мира». (Примечание Великого Сморчка — не пытайтесь это сделать, не изучив и не осознав опасности, связанные с ложным сморчком !!)

границ | Идентификация «гриба бессмертия»: оценка видового состава ганодермы в коммерческих продуктах рейши

Введение

Ganoderma — большой и разнообразный, глобально распространенный род грибов, вызывающих гниение древесины, который включает виды, вызывающие белую гниль на различных древесных породах.Кроме того, практикующие восточную традиционную медицину прописали использование лакката (блестящего) вида Ganoderma , обычно называемого «рейши» или «линчжи», в качестве профилактического противовоспалительного лечения или для повышения иммунитета (Wang et al. , 2012; Hennicke et al., 2016). В азиатских странах продукты рейши (этот термин будет использоваться в данной статье для обозначения как рейши, так и линчжи) используются уже более 2000 лет, а Ganoderma почитается как «гриб бессмертия» (Stamets, 2000). .Рейши является центральным элементом древних китайских и японских произведений искусства и ассоциируется с королевской властью, мудростью, сексуальным мастерством и вечной жизнью (Stamets, 2000). Согласно китайской и американской фармакопеям, рейши считается эликсиром от самых разных болезней (Sanodiya et al., 2009).

Упоминания о рейши как о превосходной траве, укрепляющей здоровье человека, можно найти еще в 100 г. до н. Э. (Cao et al., 2012). В настоящее время представители комплекса видов G. lucidum продолжают назначаться в традиционной медицине, для которой плодовые тела обычно выращивают, измельчают и превращают в таблетки, настойки или чаи (Stamets, 2000).В Американской травяной фармакопее G. lucidum sensu lato в основном рекомендуется для усиления иммунитета (Аптон и Петрон, 2000; Джин и др., 2012). Кроме того, восточная традиционная медицина становится популярной во всем мире, а индустрия рейши довольно прибыльна, ее объем мировой торговли превышает 2,16 миллиарда долларов (Lai et al., 2004; Cao et al., 2012). Индустрия пищевых добавок, которая состоит из витаминов, минералов, растений и т. Д., Является растущим рынком с глобальными продажами на уровне 109 миллиардов долларов, при этом ожидается, что к 2020 году продажи увеличатся почти вдвое (Binns et al., 2017). Исходя из этих цифр, на индустрию рейши приходится примерно 2% мировых продаж диетических добавок.

Недавние исследования показали, что G. lucidum sensu lato содержит около 400 биоактивных соединений, которые в основном представляют собой полисахариды и тритерпены (Sanodiya et al., 2009; Basnet et al., 2017). Эти соединения обладают противовоспалительным, радикальным поглощением кислорода, противоопухолевым, иммуностимулирующим и антимикробным действием (Paterson, 2006; Boh et al., 2007; Санодия и др., 2009; Jin et al., 2012). G. lucidum sensu lato продуцирует противогрибковый белок ганодермин, который оказывает ингибирующее действие против распространенных грибов, таких как Botrytis cinerea и Fusarium oxysporum (Wang and Ng, 2006), а также производит другие химические вещества с антибактериальным действием (Isaka et al. др., 2015; Баснет и др., 2017). Было показано, что противовирусные свойства тритерпенов, продуцируемых другим видом лаккатов, Ganoderma pfeifferi, , активны против вируса гриппа A (Mothana et al., 2003). Наконец, нематацидные свойства наблюдались при применении экстрактов Ganoderma к Heterodera glycines (Zhao et al., 2009). В дополнение к этим ингибирующим эффектам против других микробов, рейши в основном рекомендуется для повышения иммунитета (Upton and Petrone, 2000; Jin et al., 2012), с такими профилактическими качествами, как противовоспалительное, антиаллергенное, радикальное поглощение кислорода, как а также ингибирующие эффекты опухолевого роста (Lin et al., 1991; Paterson, 2006; Powell, 2006; Boh et al., 2007; Джозеф и др., 2009; Санодия и др., 2009; Jin et al., 2012). Химические и биологические свойства многих грибов вызвали интерес исследователей-фармацевтов, изучающих вторичные метаболиты, продуцируемые грибами, которые могут привести к биопроизводству новых лекарственных форм (Zhong and Xiao, 2009).

Таксономия вида laccate Ganoderma довольно запутанна, а таксономия и филогенетические отношения между таксонами все еще активно исследуются (Moncalvo et al., 1995a; Хонг и Юнг, 2004; Cao et al., 2012; Wang et al., 2012; Чжоу и др., 2015). В течение последнего столетия во многих исследованиях Ganoderma использовалось название G. lucidum для любых видов лаккатных Ganoderma , произрастающих на лиственных деревьях (Pirone, 1957; Gilbertson and Ryvarden, 1986; Sinclair and Lyon, 2005; Zhou et al. др., 2015). Точно так же коммерчески доступные наборы для выращивания рейши (GYO) и витаминные добавки, производимые и продаваемые как традиционная медицина, широко продаются как G.lucidum. Молекулярные исследования установили, что G. lucidum sensu stricto (Curtis) Karst имеет естественное географическое распространение в Европе и некоторых частях Китая, а Ganoderma lingzhi Sheng H. Wu, Y. Cao и Y.C. Дай родом из Восточной Азии (Cao et al., 2012). Кроме того, на момент написания этой статьи G. lucidum sensu lato были разделены на множество различных видов (Welti and Courtecuisse, 2010; Cao et al., 2012; Wang et al., 2012; Zhou et al., 2015; Dai et al., 2017). Наиболее широко используемым лекарственным видом является G. lingzhi , который имеет морфологические и генетические характеристики, отличные от G. lucidum .

Предполагается, что химические составные части грибов различаются для разных видов в пределах одного рода. Например, Kalogeropoulos et al. (2013) обнаружили значительные различия между тремя видами Lactarius в производстве стеролов, фенольных кислот, гидроксикоричных кислот, фенолов, флавоноидов, стильбенов и терпеновых кислот.У лекарственных грибов, таких как Fomes fomentarius, Fomitopsis pinicola, и Piptoporus betulina, также было показано, что отдельных изолятов, растущих в разных средах, различаются по фармакологическим компонентам, продуцируемым в плодовых телах (Dresch et al., 2015). Химические профили G. lucidum sensu stricto, европейского вида, и G. lingzhi, азиатского вида, значительно различаются по количеству тритерпеновой кислоты, продуцируемой базидиомами (Hennicke et al., 2016). Хотя тщательный анализ химического состава еще не проводился, вероятно, что тритерпены и другие биоактивные химические составы различаются в зависимости от различных филогенетически поддерживаемых таксонов Ganoderma , ранее включенных под названием G. lucidum (Hennicke et al., 2016) .

В Соединенных Штатах Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) не регулирует маркетинг препаратов против грибка. Как и в случае с другими травяными добавками, отсутствие регулирования может создать рынок, на котором «покупатель остерегается», поскольку целостность продукта лежит на производителе (Paterson, 2006; Raja et al., 2017). В связи с текущим быстро меняющимся пониманием характеристик Ganoderma среди видов, даже производители с благими намерениями могут столкнуться с трудностями в обеспечении того, чтобы их продукт содержал указанные виды. Несколько китайских видов, когда-то называвшихся G. lucidum , теперь считаются принадлежащими к другим видам, включая Ganoderma flexipes, G. lingzhi, Ganoderma multipileum, Ganoderma sichuanense, G. sinense, и Ganoderma tropicum (Wang et al., 2009, 2012; Cao et al., 2012; Хеннике и др., 2016; Raja et al., 2017). Опросы потребителей грибных добавок пролили некоторый свет на таксономическую идентификацию рейши; При исследовании нескольких грибковых добавок ни один из шести продуктов рейши, успешно протестированных с помощью методов штрих-кодирования ДНК, не содержал G. lucidum, , несмотря на то, что они были помечены как « G. lucidum » (Raja et al., 2017). Кроме того, исследование химических профилей, идентифицированных с помощью хроматографии, показало, что примерно 75% продуктов рейши, продаваемых в США, не соответствуют химическим профилям G.lucidum sensu stricto (Wu et al., 2017). Целью этого исследовательского проекта было изучение того, какие видов Ganoderma присутствовали в наборах GYO и производились продукты рейши, продаваемые в качестве пищевых добавок, с использованием традиционных молекулярных методов на основе ДНК и следующего поколения.

Материалы и методы

Сбор проб

Семнадцать наборов GYO, которые продавались для медицинского использования, были приобретены у компаний по выращиванию грибов в Соединенных Штатах.Эти наборы продавались в виде колонизированных деревянных дюбелей ( n = 8), инокулята опилок ( n = 7) или суспензий мицелия в шприцах ( n = 2). Все наборы были помечены как содержащие G. lucidum, , за исключением одного, который был помечен как содержащий Ganoderma curtisii. Однако один набор GYO был помечен G. lucidum sensu lato, что свидетельствует о неоднозначности этого вида. Кроме того, два производимых продукта рейши были отмечены как содержащие комбинацию видов грибов: (1) G.lucidum и Lentinula edodes, или шиитаке (продукт AL-R4) и (2) Ganoderma tsugai (предположительно неправильное написание G. tsuage ), G. lucidum, и G. изделие AL-R11). Кроме того, двадцать коммерчески доступных промышленных продуктов рейши были приобретены на основании следующих критериев: (i) были доступны для покупки в Интернете, (ii) отмечены как включающие G. lucidum , и (iii) продавались с лечебными свойствами.Готовые продукты рейши продавались в виде капсул ( n = 13), порошков ( n = 3), таблеток ( n = 1), кофе ( n = 1) или чая ( n = 1). . За исключением двух продуктов, обозначенных как G. lucidum sensu lato, признавая неоднозначность вида G. lucidum, все продукты были помечены как « G. lucidum » с маркетинговыми заявлениями, способствующими укреплению здоровья, такими как «поддерживает долголетие »,« поддерживает иммунную систему »,« детоксификатор »и« ботаническую поддержку иммунитета ».Кроме того, все производимые продукты имели следующую этикетку: « Эти утверждения не проверялись Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов». Этот продукт не предназначен для диагностики, лечения или предотвращения каких-либо заболеваний.

Культивирование и хранение наборов рейши GYO — Изоляция каждого набора GYO была произведена путем вырезания небольших кусочков (<1 мм 3 ) инокулята нереста стерильным скальпелем и помещения их на 2% агар с солодовым экстрактом (MEA) (Difco Laboratories, Франклин Лейкс, штат Нью-Джерси, США), приготовленный в соответствии с инструкциями производителя с добавлением стрептомицина (100 мг / л), 95% беномила (4 мг / л) и 85% молочной кислоты (2 мл / л), которые помогают ограничить рост бактерий и грибков у Ascomycota.Культуры поддерживали на наклонных поверхностях MEA в качестве рабочего материала, а диски с колонизированным агаром погружали в стерильную воду для длительного хранения (Marx and Daniel, 1976). Коллекции культур (ALM1-ALM17) были заархивированы в Центре исследований лесной микологии (CFMR) Коллекции культур и гербарии Лесной службы Министерства сельского хозяйства США, поддерживаются Северной исследовательской станцией и размещены в лаборатории лесных продуктов Министерства сельского хозяйства США в Мэдисоне, штат Висконсин. .

Микроскопический анализ

Мицелий из наборов GYO был визуализирован в 5% КОН на предметных стеклах с использованием светового микроскопа Nikon Eclipse 55i (Мелвилл, Нью-Йорк) для определения наличия / отсутствия хламидоспор, которые являются диагностическими признаками для некоторых видов лаккатных Ganoderma . (Дворяне, 1965; Хонг, Юнг, 2004).Для каждого набора GYO были изготовлены два предметных стекла, взяв мицелий из центра колонии зрелой (восьмидневной) культуры, выращенной на MEA. Эти слайды визуализировали при 40-кратном увеличении и сканировали на наличие / отсутствие хламидоспор. Точно так же продукты из добавок рейши были визуализированы на предметных стеклах с 5% КОН, чтобы найти какие-либо отличительные микроскопические особенности. Для каждого произведенного продукта рейши были изготовлены по два предметных держателя путем измельчения продуктов (при необходимости) и помещения небольшого количества (<1 мг) порошка в каплю КОН.Затем образцы визуализировали с 40-кратным увеличением путем сканирования каждого предметного стекла и тщательного выявления любых особенностей, таких как базидиоспоры, генеративные гифы, гифы скелета и хламидоспоры. Эти характеристики использовались для определения того, были ли продукты изготовлены из незрелых базидиом, зрелых базидиом, вегетативных культур или базидиоспор.

Экстракция ДНК, ПЦР и секвенирование по Сэнгеру

ДНК

экстрагировали из каждого продукта добавки рейши и мицелия из набора GYO с помощью мини-набора Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя.Область внутреннего транскрибируемого спейсера (ITS) рибосомной ДНК (рДНК) амплифицировали с помощью ПЦР с праймерами ITS1F (5 CTTGGTCATTTAGAGGAAGTAA) и ITS4b (5 CAGGAGACTTGTACACGGTCCAG, 1990; White et al. 1993) для идентификации видов Ganoderma , присутствующих в выборке. ITS — это универсальный штрих-код грибов, который обычно используется для определения границ видов (Schoch et al., 2012). Кроме того, фактор элонгации трансляции 1-альфа ( tef1α ) был секвенирован для всех наборов GYO с использованием праймеров EF-Gano23F (5 GGTGTCAGGCAGCTCATYGT) и EF-Gano887R (5 CGACGATGCARC), которые были разработаны. специально для амплификации видов laccate Ganoderma .Для каждой реакции ПЦР использовали следующие реагенты: 12,5 мкл Immomix Red Master Mix (Bioline, Лондон, Великобритания), 8,5 мкл H 2 O для ПЦР, 1 мкл BSA (20 мг / мл, Thermo Fisher Scientific, Waltham, MA, США), по 1 мкл каждого 10 мМ праймера и 1 нг / мкл матрицы ДНК. Реакции проводили на термоциклере MJ Mini (Bio-Rad, Геркулес, Калифорния, США) в следующих условиях термоциклера: цикл 95 ° C в течение 10 мин и затем 35 ° циклы при 94 ° C в течение 30 с, переменный отжиг. температуры 55 ° C (ITS) или 62 ° C ( tef1α ) в течение 30 с и 72 ° C в течение 1 мин, с последующим заключительным этапом наращивания при 72 ° C в течение 5 мин, а затем 4 ° C.Продукты ПЦР оценивали визуально на 1% агарозном геле, окрашенном Gel Red (Biotium, Фремонт, Калифорния, США) для подтверждения успешной амплификации. Ампликоны очищали с помощью Exo-SAP-IT (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с рекомендациями производителя. Секвенирование по Сэнгеру было выполнено с использованием тех же праймеров в лаборатории секвенирования Genewiz. Прямые и обратные последовательности для каждого образца были выровнены и визуально отредактированы с использованием GENEIOUS 10 (Kearse et al., 2012). Все сгенерированные последовательности Сэнгера были депонированы и внесены в базу данных последовательностей GenBank (см. Ниже). Последовательности ITS и tef1α были запрошены по внутренней базе данных всех известных видов Ganoderma (Zhou et al., 2015). Идентификации были основаны на 99-100% гомологии с надежными эталонными последовательностями.

Последовательность мета-штрих-кодирования Illumina

Если бы в отдельном образце присутствовало несколько таксонов, секвенирование по Сэнгеру либо дало бы чистую последовательность ДНК только для доминирующего таксона, либо дало бы смешанную последовательность, которая не была бы читаемой из-за множества перекрывающихся пиков последовательностей.Соответственно, мы выполнили секвенирование метабаркодирования Illumina в дополнение к секвенированию по Сэнгеру для всех производимых продуктов рейши, потому что это продукты, которые, скорее всего, содержат несколько видов на основе рекомендаций Raja et al. (2017). ДНК была экстрагирована из 20 произведенных продуктов рейши, как описано ранее, и все они были подвергнуты секвенированию с использованием метабаркодирования Illumina. После экстракции концентрацию ДНК измеряли с помощью NanoDrop 2000 (Thermo Fisher Scientific, Уолтем, Массачусетс, США), и образцы уравновешивали перед ПЦР до 5 нг / мкл.Для каждой реакции ПЦР использовали следующие реагенты: 12,5 мкл смеси Phusion High-Fidelity PCR Mix (New England Biolabs, Ипсвич, Массачусетс, США), 1,25 мкл каждого прямого и обратного праймера 5 мкМ и 5–10 нг ДНК. . РДНК ITS1 была амплифицирована грибковоспецифичными праймерами ITS1f (Gardes and Bruns, 1993) и ITS2 (White et al., 1990) с использованием восьми штрих-кодовых адаптеров i5 (прямой) и i7 (обратный) TruSeq (Illumina, San Diego, CA , Соединенные Штаты). Условиями ПЦР были: денатурация при 94 ° C в течение 1 минуты, затем 30 циклов при 94 ° C в течение 30 секунд, 52 ° C в течение 30 секунд, 68 ° C в течение 30 секунд и окончательное удлинение при 68 ° C в течение 7 минут, используя 5– 10 нг ДНК.В качестве положительного контроля было построено фиктивное сообщество из шести видов с использованием эквимолярных концентраций ДНК, экстрагированных из чистых культур MEA из наборов GYO или диких коллекций. Кроме того, использовали отрицательный водный контроль ПЦР. Ампликоны проверяли на 1,5% агарозных гелях, окрашенных SYBR Green (Invitrogen, Карлсбад, Калифорния, США) и нормализованных до эквимолярной концентрации с помощью набора SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA, США). Если полосы ПЦР отсутствовали на геле ( n = 5, AL-R4, AL-R9, AL-R10, AL-R12 и AL-R19), образцы готовили так же, как и другие образцы, за исключением продуктов ПЦР. разбавленный.Библиотеку очищали с помощью набора Agencourt AMPure XP (Beckman Coulter, Бреа, Калифорния, США) для удаления димеров праймеров перед секвенированием по протоколу парных концов MiSeq 300 п.н. (Illumina, Сан-Диего, Калифорния, США) в Междисциплинарной лаборатории. Центр биотехнологии Университета Флориды. Исходные данные доступны в SRA BioProject Accession SRP149732 NCBI.

Анализ мета-штрих-кодирования Illumina

Данные последовательности Illumina были обработаны с использованием конвейера AMPtk (версия 1.1.0). Вкратце, перекрывающиеся чтения 2 × 300 Illumina MiSeq были объединены с помощью USEARCH (версия 9.2.64; Edgar and Flyvbjerg, 2015), все праймеры были удалены из объединенных чтений. Все чтения размером менее 150 п.н. были удалены. Риды, длина которых меньше 300 п.н., дополнялись буквами N, а чтения, длина которых превышала 300 п.н., были обрезаны. Этот шаг обрезки / заполнения улучшает кластеризацию и другие последующие шаги (Palmer et al., 2018). Затем считанные данные были отфильтрованы по качеству с ожидаемыми ошибками менее 1,0 (Edgar and Flyvbjerg, 2015), реплицированы и сгруппированы с 97% сходством, широко принятым пороговым значением для приблизительного вида у грибов (Kõljalg et al., 2013), используя UPARSE. Все одноэлементные OTU были удалены. Полученную в результате таблицу OTU затем отфильтровали на предмет потери индекса 0,5%, следуя Palmer et al. (2018). Таксономия была присвоена с использованием подхода гибридной таксономии в AMPtk. Чтобы проверить идентичность полученных OTU, 60 последовательностей ITS, которые включали надежные эталонные последовательности, а также последовательности, полученные из последовательностей Сэнгера и Illumina (таблица 1), были выровнены с использованием плагина MAFFT (Katoh et al., 2002) в GENEIOUS 10 . Совмещение было отредактировано визуально, чтобы устранить любые двусмысленности и минимизировать различия, которые могли возникнуть в результате ошибки секвенирования.Визуально отредактированные выравнивания каждого локуса использовались для независимого филогенетического анализа с использованием максимального правдоподобия, реализованного в RAxML (Stamatakis, 2014), и байесовского вывода с использованием подключаемых модулей MrBayes (Ronquist et al., 2012) в GENEIOUS 10. Анализ RaxML использовал общий эволюционная модель с обращением времени (GTR) с быстрой загрузкой и 1000 повторений начальной загрузки, и байесовский анализ использовал эволюционную модель GTR с вариацией гамма-скорости с использованием четырех гамма-категорий для одного миллиона поколений с 4 нагретыми цепями и длиной прожига 100000 .Эти некорневые деревья были созданы для размещения ITS-последовательностей и ITS1 OTU, сгенерированных в результате секвенирования Sanger и Illumina, в клоны, идентифицированные на основе надежных эталонных последовательностей (рис. 1). Трассы и деревья были депонированы в Treebase под номером 22867.

ТАБЛИЦА 1. Образцы этикеток, видов, местоположений, типов продуктов и регистрационных номеров ITS GenBank для коммерческих продуктов рейши и эталонных последовательностей, используемых в филогенетическом анализе.

РИСУНОК 1. Неукорененное филогенетическое дерево максимального правдоподобия, реконструированное с использованием ITS-последовательностей, созданных в этом молекулярном обзоре, вместе с надежными эталонными последовательностями для идентификации на уровне видов. На ветвях указаны значения начальной загрузки, за которыми следует апостериорная вероятность байесовской филогении с идентичной топологией. Контрольные последовательности аннотированы названиями видов и номерами доступа GenBank. В этом исследовании были обнаружены кластеры заштрихованных последовательностей, а ветви последовательностей с одинаковым цветом относятся к одному и тому же виду.Контрольные последовательности для G. weberianum были включены, чтобы показать связь с идентификацией видов G. resinaaceum sensu lato. Последовательности, созданные с помощью секвенирования по Сэнгеру, помечены как AL-M # (наборы GYO reishi) и AL-R # (промышленные продукты), а последовательности, созданные с помощью Illumina MiSeq, обозначены как OTU # (промышленные продукты).

Результаты

Микроскопический анализ

Из наборов GYO 100% чистых культур имели генеративные гифы с зажимными соединениями и соответствовали морфологии колоний in vitro Ganoderma (Nobles, 1965; Adaskaveg and Gilbertson, 1989).Сорок один процент ( n = 7) из семнадцати наборов GYO конститутивно продуцировались гладкими, от интеркалярных до конечных, с двойными стенками, гиалиновыми, яйцевидными или обпириформными хламидоспорами, которые соответствуют видам в кладе Ganoderma смола (Hong и Jung , 2004). Никаких других диагностических структур в вегетативном мицелии других продуктов набора GYO не наблюдалось. Тридцать пять процентов ( n = 7) произведенных продуктов рейши предположительно были сделаны со зрелыми плодовыми телами, на основании идентификации генеративных и скелетных гиф и базидиоспор.Двадцать пять процентов ( n = 5) предположительно были получены с незрелыми плодовыми телами (генеративные и скелетные гифы, без базидиоспор), двадцать процентов ( n = 4) предположительно были получены с помощью культур (только генеративные гифы) и десять процентов ( n = 2) предположительно были сделаны только с базидиоспорами. Пять процентов ( n = 1, AL-R15-coffee) произведенных продуктов не имели окончательных салфеток Ganoderma на основе наших слайд-держателей (Таблица 2).

ТАБЛИЦА 2. Сводка результатов секвенирования по Сэнгеру, сравнивающих таксономические этикетки продукта (наборы GYO Reishi и произведенные продукты Reishi) с идентификацией штрих-кода на основе ДНК.

Идентификация на основе секвенирования по Сэнгеру

последовательности ITS были успешно амплифицированы для 100% ( n = 17) образцов набора GYO и 70% ( n = 14 из 20) произведенных продуктов рейши. Последовательности tef1α были успешно созданы для 100% ( n = 17) образцов набора GYO, и попытки амплификации изготовленных продуктов рейши не предпринимались.31 ITS-последовательность (Mh260056-Mh260086) и 17 tef1α последовательностей (Mh268053-Mh268069) депонированы в Genbank. Из наборов GYO два продукта были правильно обозначены как G. curtisii (AL-M17) и G. lucidum (AL-M16). Остальные 15 наборов GYO были ошибочно промаркированы как G. lucidum и фактически были идентифицированы как G. lingzhi ( n = 7), G. сидячий ( n = 4), G. sensu lato ( n = 3) или G.curtisii ( n = 1). Все произведенные продукты рейши, для которых мы создали последовательности, были неправильно помечены как G. lucidum, и впоследствии идентифицированы с помощью секвенирования по Сэнгеру как G. lingzhi, , за исключением одного образца (AL-R6), который был идентифицирован как G. applanatum. Эти результаты представлены в таблице 1.

Идентификация на основе мета-штрих-кодирования Illumina

Амплификация и секвенирование геномной библиотеки были успешными для 19 из 20 протестированных производимых продуктов рейши (AL-R12 не удалось).Все успешно секвенированные произведенные продукты рейши ( n = 19) содержали по крайней мере один вид Ganoderma (таблица 3). Однако G. lucidum sensu stricto не было обнаружено ни в одном из продуктов. Каждый из трех продуктов содержал только один вид Ganoderma , обнаруженный с помощью мета-штрих-кодирования Illumina: G. applanatum в AL-R6 и G. lingzhi в AL-R7 и AL-R14 (рис. 2). Мы также обнаружили несколько видов Ganoderma в 16 из 19 произведенных продуктов.Из-за предвзятости ПЦР, связанной с методами секвенирования следующего поколения, количественная оценка численности видов в сообществе на основе обилия последовательностей в образце обычно не считается надежной (Palmer et al., 2018). Тем не менее, мы смогли обнаружить шесть видов нашего ложного сообщества в нашем положительном контроле с относительно небольшой систематической ошибкой (число считываний колеблется от 6015 до 51 020). Кроме того, наш отрицательный контроль дал только одну OTU, которая не присутствовала ни в одном из наших образцов, а также не наблюдалась полоса продукта ПЦР с гель-электрофорезом, как описано ранее.Поэтому мы использовали относительное количество последовательностей для количественной оценки присутствия Ganoderma spp. в каждом образце (таблица 2). Большинство продуктов (74%, n = 14) содержали большое количество последовательностей G. lingzhi с незначительным количеством последовательностей (<5% считываний) от других видов Ganoderma или других соответствующих таксоны. Пять из 19 успешно секвенированных продуктов имели последовательность> 5% от других Ganoderma или соответствующих видов грибов, кроме G.lingzhi (рисунок 2).

ТАБЛИЦА 3. Считывание последовательности Illumina для производимых продуктов, показывающих только соответствующие таксоны, которые были либо обнаружены на этикетке продукта, либо были видами Ganoderma , обнаруженными с помощью технологии секвенирования следующего поколения с использованием ITS1.

РИСУНОК 2. Относительная последовательность считывания Illumina для каждого произведенного продукта рейши (то есть пищевых добавок). Каждый цвет представляет собой уникальный таксон, который был либо на этикетке продукта, либо вид Ganoderma , обнаруженный с помощью технологии секвенирования нового поколения с использованием платформы Illumina.«FAILED» означает, что реакция Illumina не дала данных хорошего качества. «ND» означает, что в ходе прогона / анализа Illumina ничего не было обнаружено.

Метод максимального правдоподобия и байесовская филогения, построенная с использованием последовательностей секвенирования Сэнгера и Illumina, дали идентичные результаты, поэтому представлена ​​только некорневая филогения RAxML (рис. 1). Последовательности ITS, созданные в этом исследовании, сгруппированы со значительной статистической поддержкой с эталонными последовательностями.

Обсуждение

Результаты этого исследования подчеркивают таксономические проблемы, связанные с лекарственным маркетингом видов лакката Ganoderma , которые используются для выращивания икры и / или продаются как промышленные продукты (т.е., БАДы). В большинстве наборов GYO и производимых продуктов рейши указано, что они были изготовлены с использованием « Ganoderma lucidum ». Однако продукты рейши не производились, и только один набор GYO (AL-M16) фактически содержал G. lucidum sensu stricto. Неправильная идентификация видов Ganoderma в этих продуктах считается непреднамеренной и, вероятно, из-за сложных таксономических проблем в лаккате Ganoderma , а также номенклатурных изменений, произошедших в последние годы (Cao et al., 2012; Wang et al., 2012; Чжоу и др., 2015; Хеннике и др., 2016; Дай и др., 2017). В Северной Америке и во всем мире многие виды лаккатных Ganoderma не принимались во внимание или рассматривались как синонимы G. lucidum в прошлом веке. Например, геном G. lucidum , который был секвенирован как модельный лекарственный гриб Chen et al. (2012), на самом деле G. lingzhi на основе участков ДНК rpb1 и rpb2 . Предыдущие филогенетические исследования выдвинули гипотезу о том, что видов Ganoderma имеют викариантный паттерн эволюции, при этом субклады обычно содержат сестринские таксоны в Северной Америке и в Азии-Европе (например,g., G. curtisii и G. lingzhi ) или географически разделенных регионах в пределах Северной Америки (например, Ganoderma tsugae и Ganoderma oregonense ) (Gilbertson and Ryvarden, 1986; Cao et al., 2012; Zhou et al., 2015; Hennicke et al., 2016). Основываясь на этих филогенетических паттернах, мы ожидаем, что G. lucidum и другие виды laccate Ganoderma не будут иметь глобального распространения, если они не были интродуцированы людьми. Однако общепринятой практикой прошлого века было использование эпитета « г.lucidum ”для лакката Ganoderma видов, встречающихся на лиственных породах в Азии, Европе и Северной Америке. Это межконтинентальное таксономическое объединение сделало невозможным сделать четкие выводы о биологии и химии этого культурно и экологически важного рода древесно-гниющих грибов, поскольку часто неясно, какой вид изучается в каком-либо конкретном исследовании. Эта таксономическая проблема распространилась на индустрию коммерческих лекарственных грибов, где продукты, содержащие любой вид laccate Ganoderma , обычно маркируются как содержащие G.lucidum без дополнительной информации о происхождении продукта или о том, был ли он произведен из нескольких источников или видов. Обнаружение отдельных видов в пределах комплекса видов G. lucidum подняло вопросы о выводах, сделанных в предыдущих экологических исследованиях этого рода (Loyd et al., 2018a, b). Он также выявляет потенциальные источники изменчивости химического состава и эффективности продуктов и представляет проблемы для потенциальных усилий по открытию лекарств.

Из 36 комплектов GYO и произведенных продуктов рейши, которые были помечены как включающие G.lucidum в нашем исследовании мы обнаружили, что 86% из них включали замену продукта. В большинстве случаев G. lingzhi заменяли G. lucidum. В качестве лекарственного средства эта «замена» рейши, вероятно, более подходит, чем G. lucidum , указанный на этикетке. G. lingzhi, , который произрастает в Восточной Азии, недавно был определен как один из видов, ранее ошибочно обозначенных в Азии как G. lucidum sensu lato (Cao et al., 2012). G. lingzhi , вероятно, является видом, который следует правильно ассоциировать с общими названиями «рейши» и «линчжи», используемыми в китайской медицине (Dai et al., 2017). Мы также нашли доказательства замены G. lucidum другими таксонами, в том числе G. applanatum, sensu lato, G. australe sensu lato, G. curtisii, G. gibbosum, G. resinaceum sensu lato и Г. сидячий. Эти таксоны продавались в виде наборов GYO или давали> 5% считываний последовательности Illumina для отдельного производимого продукта рейши.Все эти виды генетически отличаются от G. lucidum , который является родным для лесов умеренного пояса Европы и некоторых частей Китая (Cao et al., 2012; Wang et al., 2012). Эти другие виды также довольно сильно отличаются друг от друга морфологически. Фактически, G. applanatum, G. australe, и G. gibbosum имеют нелаккатные (тусклые) пилеи и относятся к подроду Elfvingia (Moncalvo et al., 1995b). G. curtisii и G.Resinaceum продуцируют лаккатные (блестящие) пилеи, как и в случае G. luccidum , но принадлежат к двум отдельным субкладам внутри подрода Ganoderma (Zhou et al., 2015). Основываясь на генетическом разнообразии таксонов, продаваемых в виде наборов GYO и производимых продуктов рейши, вполне вероятно, что существуют существенные различия в качестве и количестве важных с медицинской точки зрения химических веществ среди продуктов, продаваемых как «рейши» и обозначенных как « G». . lucidum . »

Видовые замены в потребительских товарах наблюдались и у других лекарственных и кулинарных грибов.К ним, в частности, относятся видов Cordyceps , Boletus и Phellinus (Dentinger and Suz, 2014; Raja et al., 2017). Raja et al. (2017) обнаружили, что многие из продуктов, маркированных Cordyceps sinensis, , высоко ценимым лекарственным грибком, были идентифицированы на основе штрих-кодов ДНК Tolypocladium inflatum , которые принадлежат к тому же отряду Hypocreales, что и C. sinensis. Точно так же Дентингер и Суз (2014) идентифицировали три новых вида Boletus в одной коммерческой упаковке китайских белых грибов, предположительно Boletus edulis, в лондонском супермаркете.Кроме того, Newmaster et al. (2013) показали, что индустрия фитотерапии (т. Е. Лекарственных растительных продуктов) страдает от тех же проблем с неправильной маркировкой. Авторы показали, что 68% протестированных продуктов (30 из 44) имели замену видов и около 33% этих продуктов содержали наполнители или загрязнители, которые не были указаны на этикетке продукта. Кроме того, было обнаружено, что некоторые из немаркированных загрязнителей / наполнителей представляют потенциальный риск для здоровья потребителей (Newmaster et al., 2013). Мы обнаружили, что Ganoderma отличается от вида, указанного на этикетке, во всех тестируемых нами продуктах, кроме двух.В более ограниченной выборке Raja et al. (2017) также показали, что продукты рейши, обозначенные как G. lucidum , были либо G. sichuanense , либо G. G. sichuanense был описан до G. lingzhi, , но голотип не соответствовал первоначальному описанию G. sichuanense. Фактически, голотип G. sichuanense имеет морфологию и ITS-последовательности, которые больше похожи на Ganoderma weberianum .Кроме того, эта путаница усугубляется тем фактом, что два названия G. lingzhi и G. sichuanense продолжают использоваться в литературе (Cao et al., 2012; Wang et al., 2012; Zhou et al. , 2015; Hennicke et al., 2016; Dai et al., 2017; Raja et al., 2017) для одного и того же вида, несмотря на путаницу, возникшую из-за типовых образцов / последовательностей G. sichuanense. Как упоминалось в предыдущих исследованиях (Cao et al., 2012; Zhou et al., 2015; Dai et al., 2017), мы предлагаем название G.lingzhi следует использовать до тех пор, пока не будет решена таксономия G. sichuanense .

Wu et al. (2017) проверили качество продуктов-добавок рейши, оценив профили полисахаридов и тритерпена с помощью хроматографии и картирования сахаридов, и обнаружили, что только 26,3% протестированных продуктов соответствовали профилю тритерпена и полисахарида аутентифицированного G. lucidum sensu. строгий образец. Согласно нашим результатам, большинство производимых продуктов рейши (т.е., пищевые добавки), и почти половина продуктов из наборов GYO, продаваемых в США, содержала азиатские виды G. lingzhi , несмотря на то, что они были обозначены как G. lucidum. Hennicke et al. (2016) показали, что G. lucidum и G. lingzhi не только генетически различаются на основе гена бета-тубулина, но также различаются химически. Экстракты G. lingzhi продуцировали значительно больше тритерпеновых кислот, чем экстракты, полученные с G.lucidum sensu stricto (Hennicke et al., 2016). Хотя продукты были маркированы неправильно, имеющиеся данные свидетельствуют о том, что G. lingzhi является наиболее широко используемым видом в традиционной китайской медицине. Однако необходимы дополнительные данные, чтобы убедиться, что другие таксоны также не использовались традиционно (Cao et al., 2012; Dai et al., 2017). Помимо G. lingzhi, в наборы GYO были включены G. curtisii, G. lucidum, G. sessile и G. resinaaceum sensu lato.Из этих таксонов G. curtisii и G. sessile произрастают в США, тогда как G. Resinaceum и G. lucidum произрастают в Европе. Кроме того, G. curtisii является родственным таксоном в Северной Америке широко культивируемого G. lingzhi (Zhou et al., 2015) и потенциально может обладать схожими экологическими, биологическими и химическими свойствами. Однако, за исключением G. lucidum sensu stricto, ни одно исследование не оценило лечебные свойства этих видов Ganoderma и их связь с широко культивируемыми G.lingzhi в Азии.

Наш микроскопический анализ показал, что, помимо видового разнообразия, компании производят продукты из рейши из различных типов тканей (например, базидиомы, мицелия, спор и т. Д.). Так же, как мало исследований, посвященных изучению биохимических различий между недавно обнаруженными таксонами Ganoderma , мало исследований изучали различия в производстве важных с медицинской точки зрения химических веществ, продуцируемых в разных типах тканей. Heleno et al.(2012) исследовали различия в антиоксидантном потенциале плодовых тел, мицелия и спор G. lucidum sensu stricto. Авторы показали, что фенольные соединения, продуцируемые G. lucidum , обладают более высоким антиоксидантным потенциалом, чем полисахариды (Heleno et al., 2012). Кроме того, экстракты плодовых тел имеют самый высокий уровень фенольных соединений по сравнению с другими типами тканей (Heleno et al., 2012). Наконец, они обнаружили, что мицелий имеет самый низкий уровень фенольных соединений, но самый высокий уровень полисахаридов (Heleno et al., 2012). Аналогичным образом Sudheer et al. (2018) оценили условия культивирования (например, концентрацию углекислого газа и свет), которые способствуют удлинению ножки («форма рога») по сравнению с образованием гвоздики («почковидный колпачок») (Рисунок 3), а также биохимические свойства, связанные с каждым из это уникальный изолят G. lucidum . «Роговая форма» показала значительно большее производство фенолов, флавоноидов, полисахаридов и ганодермина по сравнению с плодовыми телами, которые образовывали настоящий гной (почковидная форма шляпки) (Sudheer et al., 2018). Поскольку фармацевтические исследования продолжают выявлять определенные лекарственно ценные соединения, продуцируемые видами Ganoderma , и характеризовать их биологическую активность, необходимы дополнительные исследования по изучению производства соответствующих соединений в каждом типе тканей для повышения эффективности и стабильности продукта и / или для создания основы для биопроизводства конкретных желательных соединений.

РИСУНОК 3. Плодовые тела G. lingzhi , полученные из наборов GYO, продаваемых как G.lucidum . (A) Базидиомы «почковидной формы шляпки», которые производятся при хорошей вентиляции, (B) базидиомы «роговой формы», которые образуются при плохой вентиляции и высоком уровне CO. 2 и (C) «передняя форма» базидиомы, которая перешла в «почковидную форму шляпки» после воздействия на нее лучшей вентиляции.

В дополнение к медицинскому значению разнообразных видов Ganoderma , существует множество экологических последствий в отношении выращивания неместных таксонов Ganoderma за пределами их естественного ареала.Из 17 наборов GYO, приобретенных компаниями в Соединенных Штатах, 11 приобретенных наборов содержали таксонов Ganoderma , которые не являются местными для Соединенных Штатов. Эти таксоны включали G. lingzhi (уроженец Азии), G. lucidum (уроженец Европы и Азии) и G. resinaceum sensu lato (уроженец Европы). Ранее было показано, что монокариотические изоляты коренных жителей Северной Америки G. sessile (ранее считавшиеся в публикациях G. lucidum ) совместимы с монокариотическими европейскими изолятами G.смолаацеум, , вид, произрастающий в Европе (Adaskaveg, Gilbertson, 1986). Филогенетические исследования показали, что эти виды являются сестринскими таксонами внутри субклада смоляных (Zhou et al., 2015). Следовательно, возможно, что обмен генами может происходить между родственными нативными и неместными таксонами Ganoderma . Когда виды выращиваются, вероятность побега увеличивается, потому что большое количество базидиом обычно производится на небольшой территории. Бегство в дикую природу миллиардов пропагул (т.е., базидиоспоры) одного генотипа могут создать генетическое узкое место в диких популяциях. В конечном итоге это приведет к сокращению генетического разнообразия диких популяций. Этот феномен ранее был продемонстрирован на шампиньоне обыкновенном Agaricus bisporus в Калифорнии, где культивируемые генотипы ускользнули от культивирования и вытеснили местные генотипы (Kerrigan and Ross, 1989; Kerrigan, 1995). Аналогичная угроза доминирования одного культивируемого генотипа постулируется для индустрии шиитаке в ее естественном ареале в Азии (Hibbett and Donoghue, 1996).Также возможно, что интродуцированные виды или гибриды между аборигенными и интродуцированными таксонами могут быть более агрессивными грибами, вызывающими гниение древесины, чем местные виды, что может иметь непредвиденные последствия. Например, Coetzee et al. (2001) показали, что европейский генотип Armillaria mellea, , вызывающий корневую гниль дубов и других древесных кустарников, был завезен в Южную Африку более 300 лет назад, предположительно в питомниках. Совсем недавно европейский вид Ganoderma adspersum был завезен в долину Сан-Хоакин в Калифорнии на корневых подвоях миндаля и вызывает значительный распад нижней части ствола / корня, что приводит к гибели деревьев из-за ветровала (Johnson, 2017).Более того, в недавнем обзоре лаккатных видов Ganoderma в Соединенных Штатах, Лойд (2018) обнаружил две небольшие географически изолированные популяции европейского вида G. lucidum sensu stricto, которые предположительно были интродуцированы через питомник или питомник. торговля лекарственными грибами. Исследования по сохранению, направленные на изучение воздействия интродуцированных гниющих грибов, должны быть проведены для понимания разветвлений выращивания неместных Ganoderma и других коммерчески производимых видов в Соединенных Штатах.

На основании Закона о пищевых добавках и образовании (DSHEA) 1994 г. FDA не несет ответственности за анализ содержания пищевых добавок (Dodge et al., 2011). Согласно DSHEA, производитель несет ответственность за безопасность и целостность продаваемого продукта (Dodge et al., 2011). Учитывая трудности в идентификации и точном названии образцов лакката Ganoderma , нельзя винить какое-либо одно учреждение, будь то правительство, академические круги, производителей, производителей или дистрибьюторов.Однако в свете результатов этого и других исследований (Newmaster et al., 2013; Dentinger, Suz, 2014; Raja et al., 2017) США. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов должно пересмотреть способ регулирования индустрии пищевых добавок, особенно лекарственных трав и грибов. Кроме того, существует мало или совсем нет правил по выращиванию неместных видов Ganoderma за пределами их естественного ареала. До тех пор, пока не будут проведены дополнительные исследования экологических последствий выращивания таксонов Ganoderma за пределами их естественного ареала, культиваторам Ganoderma следует сосредоточиться на выращивании таксонов, специфичных для региона, чтобы избежать любых потенциальных побегов с чужеродными таксонами.

Наше исследование показывает, что наборы GYO и промышленные продукты (например, диетические добавки), продаваемые как G. lucidum , содержат несколько видов Ganoderma . Тот факт, что эти продукты имеют неточную маркировку и / или содержат смесь видов, но, тем не менее, продаются для использования в медицинских целях, вызывает вопросы относительно подлинности грибковых продуктов, используемых в этой отрасли. Также возникают важные вопросы, такие как: Все ли виды Ganoderma производят аналогичные по качеству и количеству лекарственные соединения? Может ли филогенетическое размещение видов Ganoderma предсказать присутствие или эффективность важных с медицинской точки зрения соединений? Все препараты Ganoderma (e.g., ткани базидиом, культурный мицелий, споры) одинаково полезны в лечебных целях? Представляют ли растущие неместные виды Ganoderma риск того, что они могут вытеснить естественные гниющие грибы или вызвать корневую гниль или пагубную гниль на местных деревьях? Эти вопросы следует рассмотреть в последующих исследованиях, посвященных выращиванию и производству продуктов из рейши.

Авторские взносы

Концепция статьи была совместной идеей с AL, BR, MS и JS.Работа финансировалась грантом, полученным AL, JS и RB. Работа микроскопии и молекулярной лаборатории была проведена совместными усилиями AL, CT и MJ. Рукопись написана А.Л. Рукопись редактировалась и рецензировалась AL, BR, MJ, CT, MS, RB и JS.

Финансирование

AL, RB и JS получили исследовательский грант от Международного общества лесоводства, Флоридское отделение, которое помогло оплатить некоторые из этих работ. Кроме того, компания F. A. Bartlett Tree Experts Company профинансировала некоторые из этих исследований за счет гранта фонда через Лабораторию патологии лесов Университета Флориды.MS, CT и MJ получили финансирование от Национального института продовольствия и сельского хозяйства Министерства сельского хозяйства США под номером награды FLA-PLP-005289 (для MS) и Института продовольственных и сельскохозяйственных наук Университета Флориды.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы благодарны Эрику Линдеру и Кэсси Ньюман за помощь в этом проекте.

Сноски

  1. www.genewiz.com
  2. http://amptk.readthedocs.io

Список литературы

Адаскавег Дж. И Гилбертсон Р. (1989). Культурные исследования четырех североамериканских видов в комплексе Ganoderma lucidum в сравнении с G. lucidum и G. tsugae . Mycol. Res. 92, 182–191. DOI: 10.1016 / S0953-7562 (89) 80010-3

CrossRef Полный текст | Google Scholar

Адаскавег, Дж.Э. и Гилбертсон Р. Л. (1986). Культурные исследования и генетика сексуальности Ganoderma lucidum и G. tsugae применительно к таксономии комплекса G. lucidum . Mycologia 5, 694–705. DOI: 10.2307 / 3807513

CrossRef Полный текст | Google Scholar

Баснет Б. Б., Лю Л., Бао Л. и Лю Х. (2017). Текущая и будущая перспектива антимикробной и антипаразитарной активности Ganoderma sp .: обновленная информация. Микология 8, 111–124. DOI: 10.1080 / 21501203.2017.1324529

CrossRef Полный текст | Google Scholar

Биннс, К. В., Ли, М. К., и Ли, А. Х. (2017). Проблемы и перспективы: регулирование пищевых добавок в здравоохранении. Annu. Rev. Public Health 39, 403–420. DOI: 10.1146 / annurev-publhealth-040617-013638

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бох Б., Берович М., Чжан Дж. И Чжи-Бин Л. (2007). Ganoderma lucidum и его фармацевтически активные соединения. Biotechnol. Анну. Ред. 13, 265–301. DOI: 10.1016 / S1387-2656 (07) 13010-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цао Ю., Ву С.-Х. и Дай Ю.-С. (2012). Уточнение видов призового лекарственного гриба Ganoderma «Линчжи». Fungal Divers. 56, 49–62. DOI: 10.1007 / s13225-012-0178-5

CrossRef Полный текст | Google Scholar

Chen, S., Xu, J., Liu, C., Zhu, Y., Nelson, D.R., Zhou, S., et al.(2012). Последовательность генома модельного лекарственного гриба Ganoderma lucidum . Нац. Commun. 3: 913. DOI: 10.1038 / ncomms1923

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кутзи М., Вингфилд Б. Д., Харрингтон Т. К., Стеймель Дж., Коутиньо Т. А. и Вингфилд М. Дж. (2001). Гриб корневой гнили Armillaria mellea , завезенный в Южную Африку первыми голландскими поселенцами. Мол. Ecol. 10, 387–396. DOI: 10.1046 / j.1365-294x.2001.01187.x

CrossRef Полный текст | Google Scholar

Dai, Y.-C., Zhou, L.-W., Hattori, T., Cao, Y., Stalpers, J. A., Ryvarden, L., et al. (2017). Ganoderma lingzhi (Polyporales, Basidiomycota): научный бином широко культивируемого лекарственного гриба Lingzhi. Mycol. Прог. 16, 1051–1055. DOI: 10.1007 / s11557-017-1347-4

CrossRef Полный текст | Google Scholar

Додж Т., Литт Д. и Кауфман А. (2011). Влияние здоровья и образования пищевых добавок на представления потребителей о безопасности и эффективности пищевых добавок. J. Health Commun. 16, 230–244. DOI: 10.1080 / 10810730.2010.529493

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дреш П., Агуанно М. Н., Розам К., Гриенке У., Роллингер Дж. М. и Пайнтнер У. (2015). Штамм грибов имеет значение: рост колоний и биоактивность европейских лекарственных полипов Fomes fomentarius, Fomitopsis pinicola и Piptoporus betulinus . AMB Express 5: 4. DOI: 10.1186 / s13568-014-0093-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдгар Р.К., и Фливбьерг, Х. (2015). Фильтрация ошибок, сборка пар и исправление ошибок для чтения секвенирования следующего поколения. Биоинформатика 31, 3476–3482. DOI: 10.1093 / биоинформатика / btv401

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гардес, М., и Брунс, Т. Д. (1993). Праймеры ITS с повышенной специфичностью для базидиомицетов — применение для идентификации микоризы и ржавчины. Мол. Ecol. 2, 113–118. DOI: 10.1111 / j.1365-294X.1993.tb00005.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гилбертсон Р. и Риварден Л. (1986). Североамериканские полипоры. От Abortiporus до Lindteria. Осло: Fungiflora.

Хелено, С. А., Баррос, Л., Мартинс, А., Кейруш, М. Дж. Р., Сантос-Буэлга, К., и Феррейра, И. К. (2012). Плодовые тела, споры и in vitro продуцировали мицелий Ganoderma lucidum из Северо-Восточной Португалии: сравнительное исследование антиоксидантного потенциала фенольных и полисахаридных экстрактов. Food Res. Int. 46, 135–140. DOI: 10.1016 / j.foodres.2011.12.009

CrossRef Полный текст | Google Scholar

Хеннике, Ф., Шейх-Али, З., Либиш, Т., Мачиа-Висенте, Дж. Г., Боде, Х. Б., и Пипенбринг, М. (2016). Отличие коммерчески выращиваемой Ganoderma lucidum от Ganoderma lingzhi из Европы и Восточной Азии на основе морфологии, молекулярной филогении и профилей тритерпеновой кислоты. Фитохимия 127, 29–37. DOI: 10.1016 / j.phytochem.2016.03.012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хиббетт, Д. С. и Донохью, М. Дж. (1996). Значение филогенетических исследований для сохранения генетического разнообразия грибов шиитаке. Консерв. Биол. 10, 1321–1327. DOI: 10.1046 / j.1523-1739.1996.10051321.x

CrossRef Полный текст | Google Scholar

Хонг, С.Г., Юнг, Х.С. (2004). Филогенетический анализ Ganoderma на основе почти полных последовательностей митохондриальной малой субъединицы рибосомной ДНК. Mycologia 96, 742–755. DOI: 10.1080 / 15572536.2005.11832922

CrossRef Полный текст | Google Scholar

Исака М., Чинтаном П., Саппан М., Данвисетканжана К., Бунпратуанг Т. и Чойклин Р. (2015). Противотуберкулезные тритерпены ланостана из культур базидиомицета Ganoderma sp. BCC 16642. J. Nat. Prod. 79, 161–169. DOI: 10.1021 / acs.jnatprod.5b00826

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Джин, X., Руис Бегери, Дж., Сзе, Д. М., и Чан, Г. К. (2012). Ganoderma lucidum (гриб Рейши) для лечения рака. Кокрановская база данных Syst. Ред. 6: CD007731. DOI: 10.1002 / 14651858.CD007731.pub2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Джонсон, Б. (2017). Гниение корней и ягодиц Ganoderma: новая угроза для калифорнийского миндаля , ред. Б. Джонсон и Д. М. Риццо (Дэвис, Калифорния: Калифорнийский университет).

Джозеф, С., Сабулал, Б., Джордж, В., Смина, Т. П., и Джанардханан, К. К. (2009). Антиоксидантное и противовоспалительное действие хлороформного экстракта Ganoderma lucidum , обнаруженного в Южной Индии. Sci. Pharm. 77, 111–122. DOI: 10.3797 / scipharm.0808-17

CrossRef Полный текст | Google Scholar

Калогеропулос Н., Янни А. Э., Кутроциос Г. и Алоупи М. (2013). Биоактивные микрокомпоненты и антиоксидантные свойства диких съедобных грибов с острова Лесбос, Греция. Food Chem. Toxicol. 55, 378–385. DOI: 10.1016 / j.fct.2013.01.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Като К., Мисава К., Кума К. и Мията Т. (2002). MAFFT: новый метод быстрого совмещения множественных последовательностей, основанный на быстром преобразовании Фурье. Nucleic Acids Res. 30, 3059–3066. DOI: 10.1093 / nar / gkf436

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кирс, М., Мойр, Р., Уилсон, А., Стоунз-Хавас, С., Cheung, M., Sturrock, S., et al. (2012). Geneious basic: интегрированная и расширяемая программная платформа для настольных ПК для организации и анализа данных последовательностей. Биоинформатика 28, 1647–1649. DOI: 10.1093 / биоинформатика / bts199

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Керриган, Р. У. (1995). Глобальные генетические ресурсы для разведения и выращивания Agaricus . Банка. J. Bot. 73, 973–979. DOI: 10.1139 / b95-347

CrossRef Полный текст | Google Scholar

Керриган, Р.У. и Росс И. К. (1989). Аллозимы дикой популяции Agaricus bisporus : новые аллели, новые генотипы. Mycologia 81, 433–443. DOI: 10.2307 / 3760080

CrossRef Полный текст | Google Scholar

Кылялг, У., Нильссон, Р. Х., Абаренков, К., Тедерсоо, Л., Тейлор, А. Ф., Бахрам, М., и др. (2013). К единой парадигме для идентификации грибов на основе последовательностей. Мол. Ecol. 22, 5271–5277. DOI: 10.1111 / mec.12481

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лай, Т., Гао, Ю., и Чжоу, С. (2004). Глобальный маркетинг лекарственного гриба Линчжи Ganoderma lucidum (W. Curt .: Fr.) Продукция Lloyd (Aphyllophoromycetideae) и проблемы безопасности. Внутр. J. Med. Грибы 6, 189–194. DOI: 10.1615 / IntJMedMushr.v6.i2.100

CrossRef Полный текст | Google Scholar

Лойд, А. Л. (2018). Таксономия, биология, потенциал распада и патогенность видов лаккатной (лакированной) ганодермы, присутствующих в США. Гейнсвилл, Флорида: Университет Флориды.

Лойд, А. Л., Хелд, Б. У., Линдер, Э. Р., Смит, Дж. А., и Бланшетт, Р. А. (2018a). Выявление разложения древесины четырьмя видами Ganoderma из США. Fungal Biol. 122, 254–263. DOI: 10.1016 / j.funbio.2018.01.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лойд, А. Л., Линдер, Э. Р., Энгер, Н. А., Рихтер, Б. С., Бланшетт, Р. А., и Смит, Дж. А. (2018b). Патогенность видов Ganoderma на ландшафтных деревьях юго-востока США. Завод Дис. DOI: 10.1094 / PDIS-02-18-0338-RE

CrossRef Полный текст | Google Scholar

Маркс, Д. Х., и Даниэль, В. Дж. (1976). Поддержание культур эктомикоризных и патогенных грибов растений в стерильных водных холодильных хранилищах. Банка. J. Microbiol. 22, 338–341. DOI: 10.1139 / m76-051

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Moncalvo, J.-M., Wang, H.-F., and Hseu, R.-S. (1995a). Филогения генов комплекса Ganoderma lucidum на основе последовательностей рибосомной ДНК.Сравнение с традиционными таксономическими признаками. Mycol. Res. 99, 1489–1499.

Google Scholar

Moncalvo, J.-M., Wang, H.-H., and Hseu, R.-S. (1995b). Филогенетические отношения в Ganoderma , выведенные из внутренних транскрибированных спейсеров и последовательностей 25S рибосомной ДНК. Mycologia 87, 223–238. DOI: 10.2307 / 3760908

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мотана, Р., Али, Н.А., Янсен, Р., Вегнер, У., Ментель, Р., Линдеквист, У. (2003). Противовирусные ланостаноидные тритерпены из гриба Ganoderma pfeifferi . Фитотерапия 74, 177–180. DOI: 10.1016 / S0367-326X (02) 00305-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ньюмастер, С. Г., Гргурик, М., Шанмуганандхан, Д., Рамалингам, С., и Рагупати, С. (2013). Штрих-кодирование ДНК обнаруживает загрязнение и замену в североамериканских растительных продуктах. BMC Med. 11: 222.DOI: 10.1186 / 1741-7015-11-222

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дворяне, М. К. (1965). Идентификация культур лесных гименомицетов. Банка. J. Bot. 43, 1097–1139. DOI: 10.1139 / b65-126

CrossRef Полный текст | Google Scholar

Палмер, Дж. М., Джусино, М. А., Баник, М. Т., и Линднер, Д. Л. (2018). Небиологические синтетические вспомогательные средства контроля и программный конвейер AMPtk улучшают данные микобиома. PeerJ 6: e4925.DOI: 10.7717 / peerj.4925

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пироне, П. П. (1957). Ganoderma lucidum , паразит теневых деревьев. Бык. Торри Бот. Club 84, 424–428. DOI: 10.2307 / 2482973

CrossRef Полный текст | Google Scholar

Пауэлл, М. (2006). Использование Ganoderma lucidum (Reishi) для лечения аллергических реакций, опосредованных гистамином. Townsend Lett. 274, 78–82.

Google Scholar

Раджа, Х.А., Бейкер Т. Р., Литтл Дж. Г. и Оберлис Н. Х. (2017). Штрих-кодирование ДНК для идентификации грибов, имеющих отношение к потребителю: частичное решение для сертификации продукции? Food Chem. 214, 383–392. DOI: 10.1016 / j.foodchem.2016.07.052

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ронквист, Ф., Тесленко, М., Ван Дер Марк, П., Эйрес, Д. Л., Дарлинг, А., Хона, С. и др. (2012). MrBayes 3.2: эффективный байесовский филогенетический вывод и выбор модели в большом модельном пространстве. Syst. Биол. 61, 539–542. DOI: 10.1093 / sysbio / sys029

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Санодия, Б. С., Такур, Г. С., Багел, Р. К., Прасад, Г., и Бисен, П. (2009). Ganoderma lucidum : мощный фармакологический макрогриб. Curr. Pharm. Biotechnol. 10, 717–742. DOI: 10.2174 / 1389789978757

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шох, К. Л., Зайферт, К. А., Хундорф, С., Роберт В., Спуг Дж. Л., Левеск К. А. и др. (2012). Ядерная рибосомная внутренняя транскрибируемая спейсерная область (ITS) как универсальный маркер штрих-кода ДНК для грибов. Proc. Natl. Акад. Sci. США 109, 6241–6246. DOI: 10.1073 / pnas.1117018109

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Синклер, У. А., и Лион, Х. Х. (2005). Болезни деревьев и кустарников. Нью-Йорк, штат Нью-Йорк: Comstock Publishing Associates.

Google Scholar

Стамец, П.(2000). Выращивание изысканных и лечебных грибов. Беркли, Калифорния: Ten Speed ​​Press.

Google Scholar

Судхир С., Таха З., Маникам С., Али А. и Ченг П. Г. (2018). Развитие плодовых тел пантового типа Ganoderma lucidum и определение его биохимических свойств. Fungal Biol. 122, 293–301. DOI: 10.1016 / j.funbio.2018.01.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Аптон, Р., и Петроне, К. (2000). Американская травяная фармакопея — гриб рейши — Ganoderma Lucidum. Нью-Йорк, Нью-Йорк: Американская травяная фармакопея.

Google Scholar

Wang, D.-M., Wu, S.-H., Su, C.-H., Peng, J.-T., Shih, Y.-H., and Chen, L.-C. (2009). Ganoderma multipileum , правильное название для « G. lucidum » в тропической Азии. Бот. Stud. 50, 451–458.

Google Scholar

Ван Х. и Нг Т. (2006). Ганодермин, противогрибковый белок из плодовых тел лекарственного гриба Ganoderma lucidum . Пептиды 27, 27–30. DOI: 10.1016 / j.peptides.2005.06.009

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван, X. С., Си, Р. Дж., Ли, Ю., Ван, Д. М., и Яо, Ю. Дж. (2012). Видовая принадлежность широко культивируемых в Китае Ganoderma , ‘ G. lucidum ’ (Ling-zhi). PLoS One 7: e40857. DOI: 10.1371 / journal.pone.0040857

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Велти, С., и Courtecuisse, R. (2010). Ganodermataceae во Французской Вест-Индии (Гваделупа и Мартиника). Fungal Divers. 43, 103–126. DOI: 10.1007 / s13225-010-0036-2

CrossRef Полный текст | Google Scholar

Уайт, Т. Дж., Брунс, Т., Ли, С., и Тейлор, Дж. (1990). «Амплификация и прямое секвенирование генов рибосомной РНК грибов для филогенетики», в PCR Protocols: A Guide to Methods and Applications , eds M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T.Дж. Уайт (Сан-Диего, Калифорния: Academic Press), 315–322.

PubMed Аннотация | Google Scholar

Wu, D.-T., Deng, Y., Chen, L.-X., Zhao, J., Bzhelyansky, A., and Li, S.-P. (2017). Оценка согласованности качества пищевых добавок Ganoderma lucidum , собранных в США. Sci. Реп. 7: 7792. DOI: 10.1038 / s41598-017-06336-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжао, С., Го, Ю., Лю, К., Ван, Х., и Нг, Т. (2009). Лектины, но не противогрибковые белки, проявляют активность против нематод. Environ. Toxicol. Pharmacol. 28, 265–268. DOI: 10.1016 / j.etap.2009.05.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжун, Ж.-Дж., Сяо, Ж.-Х. (2009). Вторичные метаболиты высших грибов: открытие, биоактивность и биопродукция. Биотехнология в Китае I. Берлин: Springer, 79–150. DOI: 10.1007 / 10_2008_26

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжоу, Л.-W., Cao, Y., Wu, S.-H., Vlasák, J., Li, D.-W., Li, M.-J., et al. (2015). Глобальное разнообразие комплекса Ganoderma lucidum (Ganodermataceae, Polyporales), определенное на основании морфологии и многолучевой филогении. Фитохимия 114, 7–15. DOI: 10.1016 / j.phytochem.2014.09.023

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гриб рейши: виды применения и риски

Грибы рейши относятся к числу нескольких лекарственных грибов, которые на протяжении сотен лет использовались, главным образом, в азиатских странах, для лечения инфекций.В последнее время их также использовали при лечении заболеваний легких и рака. Лекарственные грибы были одобрены в качестве дополнения к стандартным методам лечения рака в Японии и Китае более 30 лет и имеют обширную клиническую историю безопасного использования в качестве отдельных агентов или в сочетании с химиотерапией.

Гриб рейши также известен как линчжи.

Почему люди принимают гриб рейши?

Гриб рейши используется для укрепления иммунной системы, снижения стресса, улучшения сна и уменьшения усталости.Люди также принимают гриб рейши для лечения таких заболеваний, как:

Есть некоторые научные доказательства его эффективности, включая лабораторные исследования и некоторые небольшие исследования на людях. Исследователи начинают изучать химический состав этого гриба, чтобы лучше понять, как и действительно ли он работает при каждом из этих состояний.

Дозы могут зависеть от следующих факторов:

  • Ваш возраст
  • Состояние, при котором назначают гриб
  • Форма гриба
  • Ваше общее состояние здоровья

Но каждый из них представляет собой типичную пероральную суточную дозу:

  • 1.От 5 до 9 граммов сырых сушеных грибов
  • от 1 до 1,5 граммов порошка рейши
  • 1 миллилитр раствора рейши (настойки)

Можно ли получить гриб рейши естественным путем из продуктов?

Гриб рейши выращивают и продают в пищу, но он может быть жестким и горьким.

При приеме по состоянию здоровья его обычно сушат или принимают в виде экстракта, например, в форме:

Каковы риски приема гриба рейши?

Побочные эффекты. При использовании в течение трех-шести месяцев гриб рейши может вызвать аллергическую реакцию, связанную с сухостью у вас:

  • Рот
  • Горло
  • Носовые ходы

Он также может вызвать:

Риски. Прием грибов рейши может быть более рискованным, если у вас низкое кровяное давление или вы принимаете терапию для повышения кровяного давления, принимаете лекарства от диабета или у вас нарушения иммунной системы или лекарства.

Более высокие дозы гриба рейши могут повысить вероятность кровотечения у людей с очень низким количеством тромбоцитов.

Кроме того, избегайте использования гриба рейши, если вы беременны или кормите грудью, потому что не было достаточных исследований его безопасности в этих обстоятельствах.

Взаимодействия. Гриб рейши может увеличить риск кровотечения. Поговорите со своим врачом, прежде чем принимать гриб рейши, если вы принимаете антикоагулянты или антитромбоцитарные препараты, такие как:

Гриб рейши может также взаимодействовать с лекарствами от высокого кровяного давления.

Также обсудите возможные взаимодействия, если вы принимаете другие травы или добавки, которые могут препятствовать нормальному свертыванию крови или понижать артериальное давление.Гинкго и рыбий жир — два примера.

Сообщите своему врачу о любых добавках, которые вы принимаете, даже если они натуральные. Таким образом, ваш врач может проверить любые возможные побочные эффекты или взаимодействия с лекарствами или продуктами питания. Они могут сообщить вам, может ли добавка повысить ваш риск.

Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) регулирует пищевые добавки; однако он обращается с ними как с едой, а не с лекарствами. В отличие от производителей лекарств, производителям добавок не нужно доказывать, что их продукты безопасны или эффективны, прежде чем продавать их на рынке.

Грибы морель — одно из величайших сокровищ природы

Брэндон Батлер | Специально для Tribune

Сидя здесь и глядя в окно на ручей, протекающий по его берегам, я мог бы грустить, что все лучшие рыболовные реки вышли наружу. Вместо этого у меня кружится голова от волнения. В эти выходные должно светить солнце, и грибы сморчков должны выпрыгнуть из земли. Свежий жареный краппи, жареный дикая индейка и тушеные сморчки в качестве еды снова станут реальностью.

В жизни есть несколько простых радостей, которые мне нравятся больше, чем неспешная прогулка по лесу. Будь то стрельба из традиционного лука, поиск рогов, поиск новых мест для охоты или поиск индеек, я люблю проводить время на открытом воздухе без ограничений. Думаю, это делает меня странником. Тем не менее, ничто так не привлекает меня в бесцельной прогулке, как охота за грибами сморчков.

Каждый год я пишу колонку об охоте на сморчков. Когда вы ведете колонки на открытом воздухе каждую неделю в течение почти двух десятилетий, трудно не повторять ежегодное написание одних и тех же занятий.В этом году я не собираюсь вдаваться в советы о том, где искать, или что говорят эксперты о температуре почвы и тому подобном. Я просто хочу рассказать вам о том, почему я так люблю охоту за грибами.

Буквально на прошлой неделе я наблюдал, как маленькие дети охотятся за пасхальными яйцами. Внутри каждого найденного яйца был приз. Я делал это, когда был ребенком. Скорее всего, ты тоже. В нашей психике есть что-то укоренившееся в том, чтобы брать в руки блестящий предмет, находить сокровища. Сморчки — это охота за пасхальными яйцами для таких, как я.Они тоже сокровище. Вы можете найти их только на короткий период времени каждый год. Это что-то вроде сезона отпусков, который приходит и уходит. Вы с нетерпением ждете, переживаете событие, наслаждаетесь послесвечением, а затем позволяете ему дойти до следующего года.

Все это в конечном итоге потому, что сморчки такие приятные на вкус. Охота — это весело, но главное — съесть их. Вы можете не согласиться, но для тех из нас, кто любит грибы, насыщенный, ореховый, маслянистый вкус идеально обжаренного сморчка не похож ни на что, что можно купить в магазине.К счастью, насколько мне известно, никому не удалось успешно создать коммерчески выращенный рынок для сморчков. Я надеюсь, что они никогда этого не сделают. Вы должны приложить усилия и немного удачи, чтобы получить этот приз.

Я уже дважды упоминал жареные грибы. Вот как они мне нравятся. Не поймите меня неправильно, я буду есть сморчки в любом виде, но мне хочется ощутить полный вкус: вы моете и ополаскиваете, растапливаете настоящее масло в сковороде на среднем огне и медленно готовите грибы, пока они не станут в самый раз.Посыпьте немного солью и ешьте их в одиночестве. По одному. Не торопитесь жевать и наслаждайтесь каждой секундой.

Два года назад, когда я охотился на индейку в начале мая, я наткнулся на самую большую материнскую жилу, которую я когда-либо видел. Я нашла так много, что пришлось совершить две поездки. Улов покрывал вершину прямоугольного стола шести футов длиной, уложенного два друг на друга грибами. Я ел как король неделю. Я даже отдал несколько. Но потом поумнел и придумал в остальном неплохую идею.

Я протер их и заморозил разжиженные сморчки. В течение года я готовила грибной суп из сморчков и соус из сморчков. Вы представляете, как я люблю эти дары для Земли?

Я, конечно, не одинок. Грибные охотники — растущая порода. Если вы никогда не делали этого раньше, но я пробудил ваш интерес этой статьей, тогда выйдите и попробуйте. Вы можете охотиться за грибами в общественных местах вокруг вас. Национальные леса, государственные земли и парки предлагают множество мест, где можно найти себе занятие по душе.Посмотрите на водные пути и мертвые деревья. Носите с собой красивую трость, которая поможет вам соваться и выглядывать, и не забудьте обработать ее хорошим репеллентом от клещей. Кроме того, просто зашнуруйте свои походные ботинки и вперед.

Увидимся в пути.

Чтобы узнать больше о Driftwood Outdoors, посмотрите подкаст на www.driftwoodoutdoors.com или где угодно, где транслируются подкасты.

Abrams Creek Retreat and Campground, WV

Потомакское нагорье, долина реки Грибы, мхи, лишайники: Abrams Creek Retreat and Campground, WV

Экологичное жилье и кемпинг

Кемпинги, коттеджи / коттеджи, аренда типи и жилье на берегу реки

Расположен рядом с U.S. Rt. 50, В 3 милях к востоку от горы Сторм, WV

Назад на главную страницу фотоальбомов

Помощь в идентификации грибов и грибов от друга …
Большая помощь в идентификации этих грибов от Бадди Килпатрика.

Бадди изучает, собирает и ест дикие съедобные грибы и растения. около 20 лет. Он был президентом Микологической ассоциации Вашингтон в 2003 году и в течение ряда лет был редактором его информационного бюллетеня.приятель также преподавал курсы обучения взрослых по собиранию грибов в Chautauqua. Учреждение и округ Арлингтон, В.А. Образование взрослых. Провел мастер-классы по грибам. собирать пищу и использовать лечебные грибы во время ряда языческих мероприятий, в том числе Фестиваль Старвуд и День языческой гордости Вирджинии. Бадди был садовником в более 30 лет и выращивает множество интересных трав и растений. Имеет степень доктора философии в области государственной политики. Джорджа Мейсона, а в реальной жизни консультант по экономической политике и адъюнкт-профессор политики.

Посетите веб-сайт Buddy’s Eat More Toadstools, который в основном посвящен таким темам, как дикие, культивируемые, съедобные и лекарственные грибы и растения.
http://www.eatmoretoadstools.com


Оранжевый гриб британских солдат, цепляющийся за камень (M1)

Хвост индейки Древесный гриб на пне (M2)

Другой древесный гриб (M3)

Древесный гриб Jack O-Lantern? (M4)
Довольно большой.

Гриб Ganoderma — люциду или цуга.
Другое имя — рейши, или лин чжи (M5)

Лесные народные / пеньковые грибы
(также называемые опята?) (M6)

То же самое (M7)
чуть ближе

Гриб Цезарь американский (Amanita caesaris) (M8)

Гриб Цезаря, несколько дней спустя.(М9)

Гриб бурого коралла, древесный гриб с щупальцами (M10)

Красивый гриб Ganoderma в Бобровой пропасти (M11)

Пурпурный гриб Корт (M12)

Сосновый гриб (красный) гриб (M13)

Грибы и лишайники (M14)

Индийский завод по производству труб или трупов (M15)

Зловонный ложный коралл (M16)

Хохлатый коралл (белый) (M17)

подберезовик с грибком (Boletus russellii?) (M18)

Hemlock Polypore (полка для пигментного лака) (M19)

Джек-О-Фонари (M20)

Еще фонарики Jack-O-Lanterns (M21)

Грибы сыроежки (M22)

Коралл желтый роговой (M23)

Рейши (Ganoderma) Древесный гриб (M24)

Очень большой гриб (M25)

То же, другой угол (M26)

Индикатор Morel (M27)

Гигантский полипор (Meripilus giganteus) (M30)

То же (M31)

Ведьмин Масло (M32)

Седло дриад? (М33)

Пуговицы (M34)

другие пуфы (M35)

Lactarius (вероятно, L.volemus) (M36)

Лесной старик (род Strobilomyces) (M37)

Желтый пантовый коралл (M38)

Мох или растение (M39)

Прямоугольный корень, также называемый раковым корнем (M40)

Свежий фонарь из Джека (M41)

Будда, созерцающий время (M42)

Папоротники, пень и вездесущий мох (M43).

Маленькие коричневые грибы (M44)

Хвост индейки (M45)

Мухомор (возможно, мускария) (M46)

Мухомор (M47)

Толстый мох у ручья (M49)

Сад из мха и папоротника прямо над основным огненным кругом (M50)

Чешуйчатая ваза лисичка (Gomphus floccosus) (M51)

Такой же (M52)

Подробнее Рейши (M53)

и больше рейши (M54)

Гниющая полка серы (M55)

Папоротники (M56)

Клетчатые грибы из мха (M57)

Клетчатые грибы из мха (M58)

Еще моховые грибы в клетку? (М59)

Мухомор (M60)

(М61)

Джек-О-Фонарь (M62)

Поход вниз по течению обнаруживает большие валуны (M63)

…и сочная зелень весны (M64)

Желтый пантовый коралл (M65)

Мох / лишайники (M66)

Мухомор, возможно, virosa (M66)

Маленькие коричневые грибочки (M67)

Мухомор? (М68)

(М69)

Валуны и мхи возле Типи №1 (M70)

Каменная лестница на главной дороге, ведущей к кабине №1 (M71)

(М72)

Мухомор (M73)

Коралловый гриб (M74)

Маленькие белые грибы (M75)

Боровик горький (Tylopilus felleus) (M76)

подробнее Reishi (M77)

Мухомор (M78)

(М79)

Коралловый гриб (белый) (M80)

Гигантский полипор (Meripilus giganteus) (M81)

Лисичка полая (M82)

Болеты (M83)

Мухомор (M84)

Плесень белой слизи (M85)

Форма слизи собачьей рвоты (M86)

Оранжевый коралловый гриб (M87)

Подберезовик (возможно, родственник Boletus edulus (белые грибы) (M88)

То же (M89)

Мухомор (M90)

Гигрофур? (M91)

Мухомор желтый (M92)

Мухомор — цитрина или вероза? (М93)

Лисички (вероятно, Cantharellus cibarius) (M94)

Старые пуфы (M95)

Элегантный вонючий рог (M96)

Боле (съедобный, возможно, Leccinum) (M97)

Коралловый гриб с прямыми ветвями (M98)

Горький белый лактарий? (M99)

Боле (возможно, Gyroporus cyanescens) (M100)

Болеты? (M101)

Полые лисички? (M102)

То же (M103)

Скальные образования недалеко от коттеджа №1 (M104)

Сила паводка и корни деревьев (M105)

Маленькие белые болеты (M106)

Подосиновик желтый — большой (M107)

Грибок на грибе — вероятно, подберезовик (M108)

Мухомор съедобный (M109)

Подбеливатель желтый (M110)

Мухомор съедобный (M111)

Мать-природа — такой хороший художник (M112)

Она рисует мхом практически все (M113)

Лесной старик (род Strobilomyces) (M114)

То же (M115)

Мухомор (M116)

Мухомор (M117)

Мухомор (M118)

Мухомор (M119)

Другие фонарики Jack-O-Lanterns (M120)

Маленькие коричневые грибочки (M121)

Другие фонарики Jack-O-Lanterns (M122)

Другие фонарики Jack-O-Lanterns (M123)

Красивый корень дерева, окруженный мхом (M124).

Древесный гриб (Хвост индейки?), Цепляющийся за пень (M125)

Мох (M126)

Russula? (M127)

Мох / лишайники (M128)

Подберезовик каштановый (Gyroporus castaneus) (M129)

Форма (M130)

Желтый пантовый коралл (M131)

фактов о лося | Живая наука

Лоси относятся к семейству Cervidae, в которое входят карибу, олени и лоси.Как и у их сородичей, у лосей массивные рога и длинные ноги с раздвоенными копытами.

Размер

Лось, как правило, шире, чем олень, но не такой массивный, как лось. Обычно они составляют от 4 до 5 футов (от 1,2 до 1,5 метра) от копыта до плеча и весят от 325 до 1100 фунтов. (От 147 до 499 кг), по данным National Geographic. Рога лося делают его намного выше. Рога самца лося могут вырастать до 4 футов (1,2 м) над головой, что в целом составляет около 9 футов (2,7 м). У самок рогов нет.

Habitat

Лоси водятся по всему миру. По данным Сети разнообразия животных Мичиганского университета (ADW), крупные дикие популяции в основном встречаются в Северной Америке, на западе Соединенных Штатов от Канады через Восточные Скалистые горы до Нью-Мексико и на северном нижнем полуострове Мичигана. Они предпочитают леса, но их также можно встретить на сплошных вырубках, открытых горах, хвойных болотах, осиново-лиственных лесах и хвойно-лиственных лесах. Они стараются держаться подальше от густых лесов.

Привычки

Лоси — социальные животные, живущие группами, называемыми стадами. По данным Смитсоновского института, стада часто довольно большие, насчитывают 200 и более особей. Некоторые стада насчитывают более 400 членов. Стадо часто разделяется по половому признаку: самцы остаются в одной группе, а самки — в другой. Несмотря на то, что стада разделены, они являются матриархальными, что означает, что им управляет одна женщина.

Гаремы лосей — обычное явление в брачный период. У доминирующего самца будет стадо из шести самок и их годовиков.Самец будет защищать свою территорию вокруг самок, пока не закончится брачный период.

Лось наиболее активна утром и вечером. Летом лось часто мигрирует на более высокие и прохладные высоты, а зимой — на более низкие высоты.

Диета

Лоси — травоядные, то есть они едят только растительность. По данным ADW, их рацион меняется в зависимости от года: летом они едят травы, а зимой — древесные растения. В качестве любимых лакомств они предпочитают одуванчики, фиалки, ястреб, астру, клевер и грибы.

Лось собирается на кормовой территории Кэмп-Крик в северо-западном Вайоминге. (Изображение предоставлено: USGS)

Потомство

Самцов называют быками, а самок — коровами. Корова обычно рожает по одному детенышу после шестимесячного периода беременности. Детенышей лосей называют телятами, они весят от 31 до 35 фунтов. (От 14 до 16 кг) при рождении.

Уже через 20 минут теленок может самостоятельно стоять. Согласно ADW, через 16 дней теленок присоединится к стаду и завершит отъем к 60-дневному возрасту.Лось готовы к спариванию примерно в 16-месячном возрасте. Как правило, они живут от восьми до 12 лет, хотя иногда и более 20 лет.

Классификация / таксономия

Вот таксономия лося в соответствии с Интегрированной системой таксономической информации (ITIS):

Kingdom : Animalia Sub Kingdom : Bilateria Infrakingdom : Deuterostomia Phylum : Chordata 50 Subphylum Vertebrata Infraphylum : Gnathostomata Суперкласс : Tetrapoda Класс : Mammalia Подкласс : Theria Инфракласс : Eutheria Порядок : Artiodactyla Семья : Cervidae Genvinae : Cervidae Genvinae : Cervidae Подсемейство : Cervidae Genvinae : Cervus elaphus Подвиды :

  • Cervus elaphus alashanicus
  • Cervus elaphus atlanticus
  • Cervus elaphus barbarous (Барбарийский олень)
  • Cervus elaphus
  • sis
  • Cervus elaphus corsicanus (корсиканский благородный олень)
  • Cervus elaphus elaphus (Wapiti)
  • Cervus elaphus hanglu (кашмирский олень)
  • Cervus elaphus hispanensicus
  • Cervus elaphus macneilli (олень Макнейла)
  • Cervus elaphus maral
  • Cervus elaphus pannoniensis
  • Cervus elaphus pannoniensis
  • Cervus elaphus songaricus
  • Cervus elaphus xanthopygus
  • Cervus elaphus yarkandensis (олень Яркленд)

Статус сохранения

Согласно Красному списку Международного союза охраны природы (МСОП), лоси не находятся под угрозой исчезновения, поскольку популяция в целом увеличивается. , и имеет широкий распределение.По данным Смитсоновского института, сегодня в США и Канаде насчитывается более 750 000 лосей.

Прочие факты

Лося также называют вапити. Согласно National Geographic, это слово индейцев означает «светлый олень». Их еще называют благородными оленями.

У быков ежегодно отращиваются новые рога. Новые рога покрыты мягким покрытием — бархатом. Когда самцы дерутся за самцов, они стирают весь свой бархат, стучая рогами вместе во время битв за доминирование.

Рога лося имеют в общей сложности шесть зубцов или ветвей.

Дополнительные ресурсы

Как олени едят ядовитые растения, Департамент рыбы и дичи Аляски

Как олени едят ядовитые растения


Райли Вудфорд

Большинство натуральных трав и трав содержат различные ядовитые соединения, и олени, вероятно, справляются с этим, поедая различные растения.

Этим летом я наблюдал, как ситкинский чернохвостый олень бродит по горам. Молодой самец с бархатистыми рогами с колючками наклонился, чтобы срезать сердцевидные листья с низкорослой лилии, затем подошел к ядовитому растению, называемому ложным морозником, и съел колос белых цветов с его верхушки.


Как олени поедают ядовитые растения без видимого вредного воздействия? Биолог Том Хэнли исследовал питание оленей и сказал, что удивлен тем, что едят олени. И не только заводы с химической защитой.Листья тернистого дьявола часто используются в меню и летом очень популярны у оленей.

Хэнли, ученый из Тихоокеанской северо-западной исследовательской станции Лесной службы в Джуно, сказал, что олени хорошо питаются при смешанном питании. Эти браузеры поедают листья и стебли древесных растений и кустарников, а также разнотравье — многолетние и однолетние зеленые лесные растения. В отличие от травоядных, таких как крупный рогатый скот, овцы и бизоны, они очень редко едят траву.

«Олень съест понемногу почти все, что есть на улице, включая несколько укусов различных ядовитых растений», — сказал Хэнли.«Кажется, существуют пороговые уровни токсичности различных растений, и пока олени едят ниже этого порога, они в порядке».

Весной олени едят много скунсовой капусты — растения, которое содержит кристаллы ядовитого соединения, называемого щавелевой кислотой, а именно кристаллы оксалата кальция. Хэнли попробовал это на вкус и сказал, что даже крошечный кусочек молодой скунсовой капусты может часами обжечь вам рот.

«Это не похоже на химический ожог, это похоже на крошечные иголки на вашем языке», — сказал он.«Я не знаю, как это действует у них во рту, но они также поедают дьявольскую дубинку, не мигая».

Олени нацелены на скунсовую капусту, когда она впервые появляется весной, поедая желтый цветонос и зеленые листья. Он содержит ядовитые соединения, но также богат белком, что очень важно для голодных оленей после зимнего сбора постного мяса. В течение всего лета они будут есть листья, оставляя только центральный стебель. Также известно, что гуси поедают листья, а медведи роют и поедают корни.

Хэнли сказал, что токсичность варьируется в зависимости от растения.Летом листья капусты скунса менее насыщены щавелевой кислотой, чем весной. У других растений цветы могут быть менее токсичными, чем листья или корни. Это верно и для морозника ложного — корни являются наиболее токсичной частью растения.

Хэнли сказал, что, вероятно, ни один растительный олень не смог бы существовать полностью. «Даже самые лучшие продукты им было бы трудно сделать на 100% диете. Им нужна смешанная диета ».

По его словам, большинство натуральных сортов разнотравья и ягод содержат различные ядовитые соединения.И, вероятно, олени справляются с этим, поедая различные растения, безопасно проглатывая небольшое количество токсичных растений и сосредотачиваясь на растениях с более высоким питательным качеством, когда они доступны.

Олени питаются скунсовой капустой весной и летом, несмотря на присутствие в листьях щавелевой кислоты. Олень просмотрел эти листья до водянистой жилки.

«Это действительно бросает вызов попыткам определить оптимальную диету для оленей», — сказал он.

Биолог Дэйв Персон из Департамента рыбы и дичи Аляски заметил, что смешанный рацион оленей может помочь им справиться с токсинами, содержащимися в пище.Олень будет есть более одного вида растений за один прием пищи, и сочетание растений в пищеварительном тракте одновременно может минимизировать или уменьшить токсические эффекты некоторых продуктов.

В своей статье «Как дикие травоядные животные справляются с токсинами растений» в совместной публикации Университета Айдахо и Университета штата Вашингтон аспирантка Эльвия Лопес-Перес описывает еще одну диетическую стратегию. Исследователи обнаружили, что животные будут есть глину или слизывать минералы из почвы, которые имеют тенденцию буферизовать или связывать токсины и противодействовать вредному воздействию растительных соединений.

Толерантность к токсинам растений варьируется у разных видов животных. Олени-мулы более терпимы к локонам, чем вилорогие антилопы, а лоси более терпимы к сосне пондероза, чем к бизонам. Чарльз Роббинс, профессор зоологии и наук о природных ресурсах Вашингтонского государственного университета, сказал, что в некоторых случаях это происходит из-за химического состава кишечника.

У таких животных, как олени, лоси и коровы, есть симбиотические бактерии в их сетчатом рубце (первых двух из четырех их множественных желудков), которые помогают им расщеплять и переваривать растительность, которую они едят.Когда лоси переключаются с поедания зеленых растений летом на ветки и древесные брови зимой, микробы в их пищеварительном тракте приспосабливаются, и микробы, лучше приспособленные к зимнему рациону, становятся более заметными. Аналогичным образом микробная адаптация в кишечнике может быть вызвана потреблением небольших количеств токсинов растений, что может дать возможность системе животного адаптироваться к токсину. Это объясняет, почему разные особи одного вида могут лучше переносить некоторые продукты.

«Рубец, безусловно, помогает, поскольку бактерии способны выводить токсины из организма», — написал Роббинс по электронной почте. «Например, у некоторых растений есть цианогенные гликозиды, которые могут выделять цианистый водород. Адаптированные бактерии могут брать азот из цианида и превращать его в аминокислоты ». Затем олени получают выгоду как от аминокислот, так и от переваривания самих бактерий, попадающих в два других переваривающих желудка.

В других случаях это связано с анатомией животного.Многие животные могут есть растения, содержащие нейротоксины, потому что у них немного разные нервные рецепторы. Например, многие белки едят очень ядовитые для нас грибы.

Райли Вудфорд — информационный сотрудник отдела охраны дикой природы и страстный наблюдатель за оленями.


Подпишитесь, чтобы получать уведомления о новых проблемах

Получайте ежемесячные уведомления о новых выпусках и статьях.

  • Facebook
  • Твиттер
  • Google+
  • Reddit
.

Добавить комментарий

Ваш адрес email не будет опубликован.